I was wondering if someone could tell me if you can use the gui designer
in monodevelop 2.2+ with python.
Thanks,
Thomas
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo
Hi,
I would like to make a combobox with a list of strings, but I have many
problems with it. I know how to make the combobox and how to add
strings, but is it possible to get a list of strings from the combobox
and also is it possible to update the combobox with a list of strings?
(something lik
Hi,
I was wondering some things about property.
suppose I have a class like this:
class A(object):
def __init__(self, x, y):
self.__x = x
def x():
def get(self):
return self.__x
def set(self, x):
self.__x = x
#and some other code that
Hi,
I sometimes find it useful to read the source code of a module and for
example I can type string.__file__ to find the location of the string
module.
However the .__file__ method is not available for the module builtin. Is it
possible to read the source code for built in functions and if so h
Earlier today I typed the following into my pythonwin interactive
interpreter in windows xp:
int('7' * 10 ** 6)
I expected either an error message or it to get stuck and require me to
stop the process manually.
I read that unlike long integers in C, longs in python are only limited by
the amo
On 18/11/06, Chris Hengge <[EMAIL PROTECTED]> wrote:
> Not that it changes your reply, but just for my own sanity:
> int('7' * 10 ** 6) <- does this not just type-cast a char into an int?
>
> Meaning that rather then consuming 1024k as you stated, it would consume
> 2048k at the peak of the calcul
s this function designed to give up when the
input strings get too long?
Thanks in advance,
Thomas
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
onaries of userid to field value. That way I'm dealing with 10 to
50 files instead of 15500.
Also, I am inexperienced with using classes but eager to learn and
wonder if they would be any help in this case.
Any advise much appreciated and thanks in
regex of ".*?" means any number of any characters, with a non-greedy
hunger (so to speak) right?
Any ideas on what is causing this to fail?
Many thanks in advance,
Thomas
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
I'm new to python but do have a little programming knowledge with C++I
got into programming so I could build Virtual Instruments because I love the
world of sound and creating instruments that shape it...I have tried to find
a program that would be an ideal vehicle for this task...I've narrowed
Hi everyone,
I am new to Python (and to programming) and, now that I have worked
through most of Learning Python, I have set myself the exercise of
writing a little text-based program to catalogue the contents of my CD
collection.
I have written enough code to allow me to create instances
I think I will give both approaches a go, since this is just a
learning exercise anyway. Thanks very much for your help.
Oh, and sorry for accidentally quoting the whole digest last time.
Won't happen again!
Tom
On 13 Jul 2009, at 17:53, tutor-requ...@python.org wrote:
I think you are b
On 13 Jul 2009, at 22:04, "Alan Gauld"
wrote:
That's one way and you can find an example and some advice
on how to handle subclassing in the OOP topic of my tutor.
Wow; thanks! That tutorial was really useful, I will have to check
out the rest
of the site now.
I am sure this has a
Greetings,
I am
trying to use python to run a SAS program by passing the needed
parameters. I am able to start SAS, but unable to start the correct SAS
program with its parameters.
Any
assistance you could provide will be appreciated.
Tom Williams
DSHS - Research and Data Analy
again,
Tom
-Original Message-
From: Alan Gauld [mailto:[EMAIL PROTECTED]
Sent: Tuesday, February 08, 2005 1:57 PM
To: Williams, Thomas; tutor@python.org
Subject: Re: [Tutor] executing SAS and passing parameters
> I am trying to use python to run a SAS program by passing th
Here is the code I am using to invoke SAS:
import os
import sys
shell = os.environ.get('COMSPEC')
if shell is None: shell = os.environ.get('SHELL')
if shell is None: shell = 'an unknown command processor'
print 'Running under', shell
os.exe
Greetings,
I am attempting to update an Oracle table
using python. When I execute the code, the python script appears to hang,
in that nothing else happens.
As always, any assistance you can provide
will be appreciated.
Code:
connection = cx_Oracle.connect("db/[EMAIL PROTECTED
Does anyone have some examples on the use of A.M. Kuchling's Python
Cryptography Toolkit? I've tried his examples but get "AttributeError"
and "TypeError". What I'm trying to do is encrypt/decrypt a file. I'm
using Python 2.3 on xp pro.
Thanks
--
_
( )
t;bhxupds&oo`g'uou`z`" <== *confused by this output*
Close but no cigar!! *grin*
--
_
( ) Mark Thomas ASCII ribbon campaign
X www.theswamp.org - against HTML email
/ \
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
ncrypt
>
> xored = obj_xor.encrypt(str_encrypt)
> print xored
>
> obj_xor = XOR.new("string")
> print obj_xor.decrypt(xored)
>
> Kent
Excellent !!
Many thanks Kent.
--
_
( ) Mark Thomas ASCII ribbon campaign
X www.theswamp.org - against HTML email
/ \
___
Does anyone know how to prevent this error
from occurring: IOError: [Errno socket error] (10060, 'Operation timed out').
I have searched for solutions without any
success.
Tom Williams
___
Tutor maillist - Tutor@python.org
h
GAAATTGCAAATTAACTGTG
ScerACCACGTCCAATCTACCGATATTGCTGCTATGCATTATAA
SparACCACGTCCAATCTACCGATATTGCTGCTATGCATTATAA
SmikACCACGTCCAATCTACCGATATTGCTGCTATGCATTATAA
SbayACCACGTCCAATCTACCGATATTGCTGCTATGCATTATAA
--
_
( ) Mark Thomas ASCII ribb
On 7/6/05, Michael Huster <[EMAIL PROTECTED]> wrote:
> In python under windows, how can I create and access a file on the Desktop?
> The following do NOT work:
How about...
>>> userp = os.getenv('USERPROFILE') + '\\Desktop\\MyFile.txt'
>>> fo =
Hi,
I'm trying to get some IPV6 python code running under
Windows. I have installed Python 2.5.1 for Windows
using the binaries from python.org. I'm a newbie to
Python programming as well.
The code works fine under Debian and MacOSX (both
using Python 2.5)
I have rebuilt the python binaries from
d time to learn Python. There will be some major
changes in 3k, but as long as you don't have to maintain 2.6 and 3.0 in
parallel, conversion should be easy enough.
Cheers,
thomas pani
[1] http://docs.python.org/dev/3.0/whatsnew/3.0.html
[2] http://www.python.org/dev/peps/pep-3000/
_
le .dk domains
pyproject.dk
pyprojects.dk
python-project.dk
pythonprogram.dk
These might be used for project subdomains, then the programmers might add
their name in E-mail adresses. Doing this you will also marked Python projects
+ making people aware of Python as a programm
--
I assume you know that you can just open a file for reading instead of
piping cat.
thomas
James Hartley wrote:
> A Perl script can easily serve as a filter within a pipe as seen in
> the following:
>
> use strict;
> use warnings;
>
> open(IN, 'cat hell
notes on this topic this might be helpful:
http://wiki.wxpython.org/LongRunningTasks
Cheers,
Thomas Pani
Varsha Purohit wrote:
> Hello,
> i have a gui program in wxpython where i am spawning two threads.
> one for the mainloop of gui and other for some background tasks. I have
>
\" \' ()*&^%$# << '
>>> [x.strip('\' \" () * & ^ % $ # < ') for x in str.split()]
['this', 'has', 'special', 'characters', '', '', '', '']
--
_
( ) Mark Thomas ASCII ribbon campaign
X www.theswamp.org - against HTML email
/ \
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
ormation for us newbies.
--
_
( ) Mark Thomas ASCII ribbon campaign
X www.theswamp.org - against HTML email
/ \
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
can't use return in the loop
you could save them in a list or something, and after the loop return
the list.
def loop():
x = []
for i in range(10):
x.append(i)
return x
print loop()
this will print a list with all the numbers.
I hope this is what you mean.
Thomas
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
code and the test
dir is a complete copy
of the src dir but with unittest instead of code.
I have something like this but I don't know how to organize the imports in
the tests and I don't know
if this is a good idea. What do you think?
Thanks
--
Thomas Coopman
[EMAIL
On Tue, 16 Jan 2007 10:06:37 -
"Alan Gauld" <[EMAIL PROTECTED]> wrote:
>
> "Thomas Coopman" <[EMAIL PROTECTED]> wrote
> .
> > I wondered if it was possible to do something like this:
> >
> > src/
> >-a_module/
> >
On Tue, 16 Jan 2007 10:06:37 -
"Alan Gauld" <[EMAIL PROTECTED]> wrote:
>
> "Thomas Coopman" <[EMAIL PROTECTED]> wrote
> .
> > I wondered if it was possible to do something like this:
> >
> > src/
> >-a_module/
> >
On 1/17/07, Kent Johnson <[EMAIL PROTECTED]> wrote:
thomas coopman wrote:
> On Tue, 16 Jan 2007 10:06:37 -
> "Alan Gauld" <[EMAIL PROTECTED]> wrote:
>
>> "Thomas Coopman" <[EMAIL PROTECTED]> wrote
>> .
>>>
On 1/17/07, Kent Johnson <[EMAIL PROTECTED]> wrote:
Thomas Coopman wrote:
> Well I don't really
> need the circular imports but I would like to know how to do the imports
correct.
>
> Suppose that in the example that I showed only One needs Two.
>
> So then we ha
On 1/17/07, Kent Johnson <[EMAIL PROTECTED]> wrote:
Thomas Coopman wrote:
> When I run One.py from in the directory A, doesn't look python in it's
> parent directory when it can't find the module?
> And if that's not the case where and what should I add to t
On 1/26/07, OkaMthembo <[EMAIL PROTECTED]> wrote:
> how useable is vim on Windows?
Very! I've used Vim on Windows since the 5.3 version, it only gets
better. Like Alan said there is a learning curve, but once you've "got
it" there is no going back.
> i wish i could learn Unix. which distro do you
Hi,
I need a function that groups almost equal strings. It seems most easy
to me, to do this with a hash function.
So I would write a hash function like this:
string = string.replace(" ", "").lower()[0:6]
and then hash the string chars, but it should detect minor typo's, so
words with one diffe
Hi,
On Thu, 08 Feb
2007 13:07:41 +0100
Christopher Arndt <[EMAIL PROTECTED]> wrote:
> thomas coopman schrieb:
> > I need a function that groups almost equal strings. It seems most
> > easy to me, to do this with a hash function.
>
> What do you mean be "a
Hi,
I want to do something like this, don't know how to properly explain it,
so I just give you some example code
>>>class Foo(object):
>>> def method(self, arg):
>>> print arg
>>>def doSomething(object, func):
>>> object.func("test")
>>>object = Foo()
>>>doSomething(object,
On Sat, 10 Feb 2007 22:10:52 +1000
Jonathan McManus <[EMAIL PROTECTED]> wrote:
> It's pretty easy to make this work, actually. The issue is in the
> "doSomething" method.
>
> > >>>class Foo(object):
> > >>> def method(self, arg):
> > >>> print arg
> >
> > >>>def doSomething(object, func)
On Sat, 10 Feb 2007 07:55:54 -0500
Kent Johnson <[EMAIL PROTECTED]> wrote:
> thomas coopman wrote:
> > Hi,
> >
> > I want to do something like this, don't know how to properly
> > explain it, so I just give you some example code
> >
> >&
On Sat, 10 Feb 2007 09:04:15 -0500
Kent Johnson <[EMAIL PROTECTED]> wrote:
> thomas coopman wrote:
> >
> > also,
> > Is it better to use super in FooList? and how should I use it then?
>
> Actually I would say that FooList is not pulling its weight.
> SortedL
se a desktop environment, you can spawn xdg-open (from
xdg-utils) from Python. This will autodetect gnome, kde and xfce and use
their tools (gnome-open, kfmclient, exo-open).
I think on OS X/Darwin there's a similar utility called `open'.
You can use sys.platform to determine which
Hi,
dir(A) will essentially give you what you want (and a little more)
If you're only interested in classes, you can do something like:
import types
[ name for name in dir(A) if type(eval('A.'+name)) == types.ClassType ]
Thomas
Laureano Arcanio wrote:
Hi All,
I need to ha
Running IDLE 1.2.2 under MacPython 2.5 on Mac OS X 5.1.
Configured shell window to wrong size, now can't seem to find the menu
(Options > Configure) to resize the shell.
Tried going to username > Library > Preferences and removing
org.python* files, but that did not work.
Thanks!
___
On Jul 26, 2008, at 9:02 AM, Alan Gauld wrote:
"Thomas Corbett" <[EMAIL PROTECTED]> wrote
Configured shell window to wrong size, now can't seem to find the
menu (Options > Configure) to resize the shell.
Don't you just resize it then close it and the next
On Jul 27, 2008, at 7:16 AM, Tim Golden wrote:
Thomas Corbett wrote:
On Jul 26, 2008, at 9:02 AM, Alan Gauld wrote:
"Thomas Corbett" <[EMAIL PROTECTED]> wrote
Configured shell window to wrong size, now can't seem to find the
menu (Options > Configure) to resiz
0002
In [2]: from decimal import Decimal
In [3]: Decimal('0.2') * 2
Out[3]: Decimal("0.4")
thomas
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
This might be helpful:
http://www.boddie.org.uk/python/XML_intro.html
Have fun!
Thomas
Dinesh B Vadhia schrieb:
I have a large number of xml files that I want to convert into text
format. What is the best and easiest way to do this? Thanks!
Dinesh
d like to see test report for each method executed in 'for' loop.
Is it possible?
PS. Sorry for my ignorance, I just started to learn Python last week.
Thanks,
Thomas
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
On Tue, Jan 10, 2012 at 3:31 PM, Walter Prins wrote:
> Hi,
>
> On 10 January 2012 12:15, Thomas Maier wrote:
>> This code works without py.test or nosetests. For example if I use print
>> instead of 'assert'.
>> Both py.test and nosetests failed to execut
cts, etc all at the same level:
>
> dict = {}
> dict['mylist'] = [1,2,3]
> dict['mystring'] = 'string'
> dict['mynum'] = 4
> dict['anotherdict'] = {}
> dict['anotherdict']['anotherstring'] = 'string2'
>
Hi David,
Mixed data types in nested data structure are possible in Perl as well:
%hash = ();
$hash{'mylist'} = [1,2,3];
$hash{'mystring'} = 'string';
$hash{'mynum'} = 4;
$hash{'anotherhash'} = {};
$hash{'anotherhash'}{'anotherstring'} = 'string2';
Thomas
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
Please help a newbie
Was able to write and successfully run this but I can't seem to be able to
"save" it
Luckily I had saved it to Word and then I was able to copy and paste it back
into PyScripter.
I'm using
Python Scripter Version 2.5.3.0 x86
*** Python 2.7.2 (default, Jun 1
I'm trying to move a Python 2.x program to Python 3.x. When I try to import
tkinter I get the error message that no module _tkinter can be found. I've
tried sudo apt-get install python-tk. While this command works, there is no
difference in the result. This problem has only cropped up after I chang
I would appreciate a logical explanation for why the "else" statement in
the 2nd script isn't working properly.
I'm running Python v2.7.8 on a Windows 7 Ultimate VM via Command prompt and
my scripts are created and edited via Notepad++ v6.7.3
*Warm regards,*
*Olaoluwa O. Thomas,*
Hi All,
I sent this forwarded email earlier but hadn't subscribed to the mailing
list so I guess that's why I didn't get a response.
Please review and advise.
*Warm regards,*
*Olaoluwa O. Thomas,*
*+2347068392705*
-- Forwarded message --
From: Olaoluwa Thomas
ay is "+str(round(gross, 4))
I'm gonna add Try and Except to make it more responsive.
Thanks a lot!
*Warm regards,*
*Olaoluwa O. Thomas,*
*+2347068392705*
On Sun, May 1, 2016 at 2:00 AM, Alan Gauld via Tutor
wrote:
> On 01/05/16 01:16, Alan Gauld via Tutor wrote:
>
> > I c
e)
elif hours >= 0 and hours <= 40:
gross = hours * rate
print "Your Gross pay is "+str(round(gross, 4))
computepay()
What am I doing wrong?
*Warm regards,*
*Olaoluwa O. Thomas,*
*+2347068392705*
___
Tutor maillist -
wrote:
> On Sun, May 01, 2016 at 5:34 PM, Olaoluwa Thomas
> wrote:
>
> The novice Python programmer is back.
>
> I'm trying to incorporate a function and its call in the GrossPay.py
> script
> that Alan solved for me.
> It computes total pay based on two in
Gotcha.
*Warm regards,*
*Olaoluwa O. Thomas,*
*+2347068392705*
On Sun, May 1, 2016 at 7:14 PM, Alan Gauld via Tutor
wrote:
> On 01/05/16 14:38, Olaoluwa Thomas wrote:
>
> > Thanks for your feedback. Please do not hesitate to provide more as I
> shall
> > email you per
the output in the attached screenshot
[image: Inline image 2]
whereas I want only one list containing strings not nested lists.
Any help would be appreciated.
*Warm regards,*
*Olaoluwa O. Thomas,*
*+2347068392705*
___
Tutor maillist - Tutor@pyt
.sort()
print lst
I named the file WordExtract.py since it does just that. :)
*Warm regards,*
*Olaoluwa O. Thomas,*
*+2347068392705*
On Thu, Jun 2, 2016 at 6:44 PM, Steven D'Aprano wrote:
> On Thu, Jun 02, 2016 at 06:05:43PM +0100, Olaoluwa Thomas wrote:
>
> > fname = raw_input
Hi there,
you have an idea where I can find NumPy and SciPy windows *.exe-files for
Python 3.5?
Thanks for any help!
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
https://mail.python.org/mailman/listinfo/tutor
hi,
I am a beginner. I am using a unix sytem (ubuntu 12.10). Python 2.7.3
is installed in my system. I found out that Python has version upto 3.3.2.
Should I update my python version? Is the syntaxes of the each version
different?
Thanks,
Thomas
Thank you very much..!! I am starting to learn python for my Bioinformatics
work, so I would look for the version that has libraries helpful for me..
On Mon, May 20, 2013 at 6:38 PM, Dave Angel wrote:
> On 05/20/2013 05:59 AM, Amal Thomas wrote:
>
>> hi,
>> I am a begi
Mitya,
Why is it best in this situation to use range() rather than a while
loop? Curious about best practices for the various iterating
functions. Thanks!
> There are a few issues here:
> * variable names should be lower case
> * for this case it's best to use for loop with range()
> * you calcul
to do this.
Working on
Python 3.3.1,ubuntu 13.04(Linux 3.8.0-29-generic x64)
Thanks
--
*AMAL THOMAS *
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
https://mail.python.org/mailman/listinfo/tutor
f.close()for lines in
content: *
*content.close()*
Now I have found that memory use is roughly 1.5 times the size of text
file. Previously it was around 4-5 times. Its remarkable change. Waiting
for more suggestions.
Thanks,
On Mon, Nov 4, 2013 at 5:05 PM, Alan Gauld wrote:
> On 04/11/13 11:07
Yes I have found that after loading to RAM and then reading lines by lines
saves a huge amount of time since my text files are very huge.
On Mon, Nov 4, 2013 at 6:46 PM, Alan Gauld wrote:
> On 04/11/13 13:06, Amal Thomas wrote:
>
> Present code:
>>
>>
>> *f = op
in time.
Thanks,
On Mon, Nov 4, 2013 at 7:11 PM, Peter Otten <__pete...@web.de> wrote:
> Amal Thomas wrote:
>
> > Yes I have found that after loading to RAM and then reading lines by
> lines
> > saves a huge amount of time since my text files are very huge.
>
>
Mon, Nov 4, 2013 at 7:16 PM, William Ray Wing wrote:
> On Nov 4, 2013, at 8:30 AM, Amal Thomas wrote:
> How long are the lines in your file? In particular, are they many
> hundreds or thousands of characters long, or are they only few hundred
> characters, say 200 or less?
>
> U
@Dave: thanks.. By the way I am running my codes on a server with about
100GB ram but I cant afford my code to use 4-5 times the size of the text
file. Now I am using read() / readlines() , these seems to be more
efficient in memory usage than io.StringIO(f.read()).
On Mon, Nov 4, 2013 at 9:23 P
way that is clear and understandable, then try to optimize
> it if necessary.
>
>
--
*AMAL THOMAS*
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
https://mail.python.org/mailman/listinfo/tutor
filename).st_size)
f = open(filename)
content = f.read()
print("Length of content actually read:", len(content))
print("Current file position:", f.tell())
f.close()
and send us the output.
--
*AMAL THOMAS*
___
Tutor maillist - T
ry efficiency is easy, do it line by line off the disk.
>
> This assumes that you can process one line at a time, sequentially. I
> expect that is not the case.
>
>
> --
> Steven
> ___
> Tutor maillist - Tutor@python.org
> To unsubscribe or change subscript
On Mon, Nov 4, 2013 at 10:00 PM, Steven D'Aprano
wrote:
>
>
> import os
> filename = "YOUR FILE NAME HERE"
> print("File size:", os.stat(filename).st_size)
> f = open(filename)
> content = f.read()
> print("Length of content actually read:", len(content))
> print("Current file position:", f.tell(
Write a function named SSN2Name with an interactive loop. The function takes
the dictionary named data as
input argument where this dictionary stores the key, value pairs of
SSN, name of person. The SSN is in the string format 'xxx-xx-' and
name is also a string. Each iteration of the func
Hi,
I am new to python3. I am working in computational biology. I need to
submit many sequence (one by one) to a http web server (
http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form) . After the
processing I need to download the output file. There is an offline package
for this server but cer
-Form )
3. Then further steps downloading the output..
Thanks,
On Fri, Dec 13, 2013 at 12:19 AM, Joel Goldstick
wrote:
>
>
>
> On Thu, Dec 12, 2013 at 1:41 PM, Amal Thomas wrote:
>
>> Hi,
>>
>> I am new to python3. I am working in computational biology. I need t
On Fri, Dec 13, 2013 at 12:29 AM, Joel Goldstick
wrote:
>
>
> So, read the Requests tutorial, and study the POST examples as POST is the
> http method that is used when filling in a form. First you will need to
> examine the form to learn the names of the fields you need to provide data
> for.
>
I am teaching my students Python the second semester using www.LearnStreet.com
( http://www.learnstreet.com/ ). I am in need of some help. I am having a
problem with the Lists-Set 1 exercise 18. The problem is below. I have put in
several codes and the output is 5, which is the right answer.
Hey all so I'm new to python(like 2 days ago new) I need to find the device
address, usb port, and number of times the error occurs Heres what I have:
import re import csv
import reimport csvf = open("file.txt", "r") #location of log file
searchlines = f.readlines() #create list
s or loops.
Regards,
Thomas Güttler
--
Thomas Guettler http://www.thomas-guettler.de/
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
https://mail.python.org/mailman/listinfo/tutor
Am 18.04.2017 um 13:17 schrieb Peter Otten:
Thomas Güttler wrote:
I would like to have read-only class properties in Python.
I found this
http://stackoverflow.com/questions/128573/using-property-on-classmethods
But there are a lot of discussions of things which I don't understand.
I wa
Am 19.04.2017 um 09:43 schrieb Alan Gauld via Tutor:
On 19/04/17 08:28, Thomas Güttler wrote:
Nice, if it is that simple.
Is there a reason why this is not in the standard library?
Probably because it is such a rare use case and because
its not that hard to do yourself if you really need
Am 19.04.2017 um 11:16 schrieb Steven D'Aprano:
On Wed, Apr 19, 2017 at 09:28:26AM +0200, Thomas Güttler wrote:
[code for a classproperty]
Nice, if it is that simple.
Is there a reason why this is not in the standard library?
I haven't had a chance to test Peter's classpr
Am 20.04.2017 um 14:26 schrieb Steven D'Aprano:
On Thu, Apr 20, 2017 at 10:39:57AM +0200, Thomas Güttler wrote:
- its hard to get classproperty to work right.
What is "righ"?
In my case a read-only classproperty is enough. Inheritance should be
supported.
I don't
es, now I understand you. Thank you
Regards,
Thomas Güttler
--
Thomas Guettler http://www.thomas-guettler.de/
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
https://mail.python.org/mailman/listinfo/tutor
several years and I use console_script in entry_points of
setup.py.
I am very unsure if this is the right way if you want to teach a new comers the
joy of python.
In the current context we want to translate a bunch of shell scripts to python
scripts.
What do you think?
Regards,
Thomas
setup.py), as opposed to just putting the script
somewhere in $PATH.
Up to now I never did this. Maybe I will do this in the future.
thank you,
Thomas Güttler
--
Thomas Guettler http://www.thomas-guettler.de/
___
Tutor maillist - Tutor@python.org
To
w the difference between python scripts and python code files.
Regards,
thomas
--
Thomas Guettler http://www.thomas-guettler.de/
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
https://mail.python.org/mailman/listinfo/tutor
Am 02.08.2017 um 05:51 schrieb Steven D'Aprano:
On Wed, Aug 02, 2017 at 11:22:00AM +1000, Ben Finney wrote:
Steven D'Aprano writes:
On Tue, Aug 01, 2017 at 04:54:40PM +0200, Thomas Güttler wrote:
[...]
I use Python since several years and I use console_script in
entry_points o
Am 02.08.2017 um 18:06 schrieb Wolfgang Maier:
On 08/02/2017 04:57 PM, Steven D'Aprano wrote:
On Wed, Aug 02, 2017 at 10:48:39PM +1000, Ben Finney wrote:
Thomas Güttler writes:
Maybe I am doing something wrong. I was proud because I did use
“console_scripts” entry points.
Did so
Am 04.08.2017 um 02:50 schrieb Ben Finney:
Thomas Güttler writes:
Why are there two ways: "script" vs "console_scripts entry-point"?
Because Distutils implements only ‘scripts’, and that's not capable
enough for what people need so Setuptools implements entry poi
Am 05.08.2017 um 06:14 schrieb Ben Finney:
Thomas Güttler writes:
The underlaying question is: Imangine you are a newcomer.
A newcomer is in a tough position when it comes to packaging and
distributing Python code, especially the command-line programs.
There has been significant progress
Am 08.08.2017 um 12:56 schrieb Chris Warrick:
On 8 August 2017 at 03:30, Ben Finney wrote:
Thomas Güttler writes:
Why is "the sane default is 'use console_scripts entry-point in
setup.py'" not a good answer?
Because third-party Setuptools is required for entry point
ve no clue. Is it 5%, 10%, 15% ...?
I know there is no definite answer to this question. But you can guess this
better than me.
Regards,
Thomas Güttler
Am 10.08.2017 um 12:01 schrieb Chris Warrick:
> On 9 August 2017 at 23:15, Steven D'Aprano wrote:
>> On Tue, Aug 08, 2017 at
Am 13.08.2017 um 02:12 schrieb Steven D'Aprano:
On Fri, Aug 11, 2017 at 02:35:00PM +0200, Thomas Güttler wrote:
How high is the percentage of python installation which don't have
setuptools?
I have no clue. Is it 5%, 10%, 15% ...?
I know there is no definite answer to this que
1 - 100 of 139 matches
Mail list logo
