Re: [Tutor] Python regular expression

[Max Noel]

On Dec 3, 2004, at 21:34, Rick Muller wrote:
The file type you mention is also called an INI file,
and is used for Windows initialization scripts, among
other things.
There's a nice recipe on this in the Python Cookbook:
http://aspn.activestate.com/ASPN/Cookbook/Python/Recipe/65334
This will read your file in as a dictionary. You can
then do searches through lists of the keys:
mydict = LoadConfig(file.ini)
for key in mydict.keys():
if re.search(key,"_at"): do_something(mydict[key])
Given the size of the file, I don't think that's a good idea...
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  [EMAIL PROTECTED]
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Accuracy of time.sleep()

[Max Noel]

On Dec 4, 2004, at 14:24, Dave S wrote:
OK I may be pushing it,  ;-)
I need a script to sleep from any point to 8:05AM when in needs to 
re-start.

So I calculate the number of seconds with the following 
	IMO, instead of doing this you should use cron to make your script 
start at 08:05. It's probably cleaner.
(and yes, there are some versions of cron for Windows -- I don't know 
where they can be found, but I used one called nnCron Lite at my job 
this summer)

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  [EMAIL PROTECTED]
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Simple RPN calculator

[Max Noel]

On Dec 4, 2004, at 23:30, Alan Gauld wrote:
to make it request for input(s) of say a simple math like  "1 2 3 4
5 + - * /".
Look at raw_input()
But if you are that much of a beginner you need to take several
steps back and try one of the tutorials, they all cover raw_input
fairly early on...
And finally doesn't RPN put the operators first? Or is it me thats
getting confused fromtoo much Lisping recently?...
	Nope, RPN calculators (such as the HP48GX, IMHO the best calculator 
ever made) require you to input the operands first, then the operators. 
It's both easier to implement and more intuitive (not to mention way 
faster to both input and compute) once you've gotten the hang of it.
	You can probably do a very basic RPN calculator in less than a hundred 
lines of code, using raw_input() and a stack (well, a list's append() 
and pop() methods).

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  [EMAIL PROTECTED]
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] hello.py: line 1: print: command not found

[Max Noel]

On Dec 5, 2004, at 00:53, Cullen Newsom wrote:
Hello List,
Here is my Error:
hello.py: line 1: print: command not found
Here is my cat hello.py:

[EMAIL PROTECTED]:~> cat hello.py
#!/usr/bin/python
print "Hello, world!"
[EMAIL PROTECTED]:~>

I know this is a Linux question (or SuSE question) as much
as a python question, but I do not think there is a more
appropriate place to ask this question, and hopefully it will
help save someone some time and frustration, especially since a
person new to Python might well believe it to be a problem with
Python.
Anyone know the proper thing to set, or change?  Thanks.
Cullen
	How are you running your script? Are you doing a basic "python 
Hello.py", or have you set Hello.py to +x and are you relying on the 
first line to tell the script where the Python interpreter is?

	If it's answer #2, you should try replacing your first line with 
"#!/usr/bin/env python" , and see what happens.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  [EMAIL PROTECTED]
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Simple RPN calculator

[Max Noel]

On Dec 5, 2004, at 05:31, Liam Clarke wrote:
RPN calculator, with operators and operands separate? Sounds
counter-intuitive to me.
What's the advantage I'm missing?
	Well, the best way to explain is to take an example. Let's say you 
want to calculate ((2 + 5) * 3 - (4 / 6)) * ((8 - 2 * 3) / 9 + (10 - 
1))
	Using a conventional calculator, you'd input the entire expression as 
above. Considering you have a good calculator (i.e. the parens are not 
shifted), that's at least 34 keystrokes, you have to get the parens 
right, and the calculator, which is idling as you type the expression, 
requires some extra processing time as soon as you hit "enter" to turn 
it into something it can understand.
	Now, with a RPN calculator, you input your expression as a tree, where 
the leaves are the operands and the nodes are the operators, in the 
order where they have to be processed. In other words, if you were 
using a HP48, here's what you'd be inputting:

2
5
+
3
*
4
6
/
8
2
3
*
-
9
/
10
1
-
+
*
	What happens, is that every time you enter an operand (in our case, a 
number), it's pushed in a stack (which is visible on the screen). And 
every time you enter an operator, it is applied to the last two 
operands you entered (they get popped out of the stack) and the result 
is pushed back in.
	The economy in keystrokes (32 in that case, given that you have to hit 
enter after each operand, but operators can be set up so that you 
don't) is marginal. However:
1) You don't need parentheses any more. You don't have to worry about 
forgetting to close one, or closing one at the wrong place. In fact, 
you don't even need to remember the operator priorities.
2) The calculator is working as you type: when you enter an operator, 
it knows it can compute an operation, unambiguously -- so it does. As a 
result, RPN calculators often "feel" faster. And since your keystrokes 
are buffered, you don't even have to worry about slow elementary 
operations.
3) Not only does the calculator feel faster, it also is faster. 
Traditional calculators have to parse the algebraic expression to 
actually convert it to a RPN-like format that can then be evaluated. 
RPN calculators don't have to. Most RPN calculators also include an 
algebraic mode to allow you to see the difference; in the case of the 
HP48 series, using said algebraic mode immediately makes you feel the 
calculator's main weakness: its processor is ridiculously slow (4 MHz 
4-bit Saturn CPU). But when using the calculator in RPN mode, it takes 
a TI-92 (which sports a 10 MHz 68000) to beat it. Not too bad for a 
machine that dates back to 1990.

	All of this, combined to a powerful programming language (RPL -- 
Reverse Polish Lisp) and a few other interesting features (the most 
noticeable being almost out-of-the-box Assembly programming 
capabilities) gave the HP48 somewhat of a cult following, and an 
incredible game development community: by the time mine gave up the 
ghost about 6 years ago, there were perfect conversions of Lemmings and 
Civilization, Dune 2 was well on its way, artists were displaying 
pictures in 16-greyscale on a screen that has a depth of 1 bit, playing 
PCM sound on the shittiest buzzer in the world, and people were using 
the IR data capabilities of the 48 to turn it into a TV remote. But I 
digress ;)

	In any case, it takes a while to get used to RPN, but once you get the 
hang of it, you feel frustrated when you come back to regular algebraic 
notation.
	Although as far as pocket calculators are concerned, you don't have a 
choice anymore -- HP stopped producing calculators a few years ago, 
having basically done nothing in 15 years to improve the design of the 
48/49 series. A shame, really. I call it the "Commodore effect".


P.S.
Nice Shodan quote Max ;)
Hehe... Thanks.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  [EMAIL PROTECTED]
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Removing/Handing large blocks of text

[Max Noel]

On Dec 8, 2004, at 14:42, Jesse Noller wrote:
Hello,
I'm trying to do some text processing with python on a farily large
text file (actually, XML, but I am handling it as plaintext as all I
need to do is find/replace/move) and I am having problems with trying
to identify two lines in the text file, and remove everything in
between those two lines (but not the two lines) and then write the
file back (I know the file IO part).
	Okay, here are some hints: you need to identify when you enter a  
block and when you exit a  block, keeping in mind that this may 
happen on the same line (e.g. blah). The rest is trivial.
	The rest of your message is included as a spoiler space if you want to 
find the solution by yourself -- however, a 17-line program that does 
that is included at the end of this message. It prints the resulting 
file to the standard out, for added flexibility: if you want the result 
to be in a file, just redirect stdout (python blah.py > out.txt).

	Oh, one last thing: don't use readlines(), it uses up a lot of memory 
(especially with big files), and you don't need it since you're reading 
the file sequentially. Use the file iterator instead.

I'm trying to do this with the re module - the two tags looks like:

...
a bunch of text (~1500 lines)
...

I need to identify the first tag, and the second, and unconditionally
strip out everything in between those two tags, making it look like:


I'm familiar with using read/readlines to pull the file into memory
and alter the contents via string.replace(str, newstr) but I am not
sure where to begin with this other than the typical open/readlines.
I'd start with something like:
re1 = re.compile('^\')
re2 = re.compile('^\<\/foo\>')
f = open('foobar.txt', 'r')
for lines in f.readlines()
match = re.match(re1, line)
But I'm lost after this point really, as I can identify the two lines,
but I am not sure how to do the processing.
thank you
-jesse
___
Tutor maillist  -  [EMAIL PROTECTED]
http://mail.python.org/mailman/listinfo/tutor

#!/usr/bin/env python
import sre
reStart = sre.compile('^\s*\')
reEnd = sre.compile('\\s*$')
inBlock = False
fileSource = open('foobar.txt')
for line in fileSource:
if reStart.match(line): inBlock = True
if not inBlock: print line
if reEnd.match(line): inBlock = False
fileSource.close()

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  [EMAIL PROTECTED]
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] "TypeError: 'int' object is not callable"??

[Max Noel]

On Dec 8, 2004, at 17:01, Dick Moores wrote:
I got this error msg for this line of code:
n = -(2(a**3.0)/27.0 - a*b/3.0 + c)
(where a = 1, b = 2, c = 3)
And was baffled until I realized the line should be
n = -(2*(a**3.0)/27.0 - a*b/3.0 + c)
But I still don't understand what "callable" means. Can someone help?
	Basically, when you try to execute your first line, the program tries 
to call the function 2 on the argument (a**3.0). Which of course fails, 
because 2 is an int, not a "callable" object (function, method, lambda 
or class). Hence "'int' object is not callable".

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  [EMAIL PROTECTED]
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] AttributeError: instance has no __call__ method

[Max Noel]

On Dec 16, 2004, at 03:56, Marc Gartler wrote:
Hi everybody,
Prior to this chunk of code 'glass' has been chosen from a list of 
colors via user input, and I now want to have that choice connect to 
one of several possible classes:

def glass_type(glasstype):
if glasstype == 'Red':
myglass = RedGlassCost()
elif glasstype == 'Blue':
myglass = BlueGlassCost()
elif glasstype == 'Yellow':
myglass = YellowGlassCost()
return myglass
glasschoice = glass_type(glass)
myglass = glasschoice()
I've tried various approaches and keep getting different errors.  But 
this one seems closest to my goal, as I know it is at least passing 
'glass' into the function:

AttributeError: RedGlassCost instance has no __call__ method
What is this trying to tell me?  Or is that irrelevant as I would be 
better off trying some other approach altogether?
Can we see your code for the *GlassCost classes?
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

--
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  [EMAIL PROTECTED]
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] AttributeError: instance has no __call__ method

[Max Noel]

On Dec 16, 2004, at 04:20, Max Noel wrote:
def glass_type(glasstype):
if glasstype == 'Red':
myglass = RedGlassCost()
elif glasstype == 'Blue':
myglass = BlueGlassCost()
elif glasstype == 'Yellow':
myglass = YellowGlassCost()
return myglass
glasschoice = glass_type(glass)
myglass = glasschoice()
	Can we see your code for the *GlassCost classes?
	Nevermind, I just figured out the problem. RedGlassCost() returns an 
instance of the RedGlassCost class, whereas RedGlassCost is the class 
itself. Thus, you need to remove the parentheses either in the 
def_glasstype function (you then return a class, affect it to 
glasschoice and then create an instance of it by instanciating 
glasschoice) or in your last line (glass_type returns an instance of 
the class you want).

-- Max
___
Tutor maillist  -  [EMAIL PROTECTED]
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Regexp Not Matching on Numbers?

[Max Noel]

On Dec 14, 2004, at 18:15, Gooch, John wrote:
This is weird. I have a script that checks walks through directories, 
checks
to see if their name matches a certain format ( regular expression ), 
and
then prints out what it finds. However, it refuses to ever match on 
numbers
unless the regexp is ".*". So far I have tried the following regular
expressions:
"\d+"
"\d*"
"\W+"
"\W*"
"[1-9]+"
and more...
I think you have to escape the backslashes.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  [EMAIL PROTECTED]
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Printing two elements in a list

[Max Noel]

On Dec 19, 2004, at 06:16, Jacob S. wrote:
Would this work for you?
a = ['Name = stuff','CGTATAGCTAGCTA','Name = stuff','CGATATGCCGGCTA']
for index,thing in enumerate(a):
if "Name=" in thing:
del a[index]
I know, that it might be slow, but I thought that maybe it would hold 
its
own because it doesn't have to import the re module, everything's 
builtin,
etc.

HTH,
Jacob
A faster way to do this would be to use something like:
if thing.beginswith("Name"): del a[index]
-- Max
--
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  [EMAIL PROTECTED]
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Popen? or something else

[Max Noel]

On Dec 22, 2004, at 22:24, Israel C. Evans wrote:
Fun!
testo = [line for line in commands.getoutput('ls -la').split('\n')]
for line in testo:
   print line
spits out nicely formatted ls data.
It's Shelly!
I haven't tried it, but the above code looks like it could be 
simplified to:

for line in commands.getoutput('ls -la').split('\n'):
print line
Or, of course, the obvious:
print commands.getoutput('ls -la')
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  [EMAIL PROTECTED]
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Am I storeing up problems ?

[Max Noel]

On Jan 2, 2005, at 23:00, Danny Yoo wrote:
(Aside: one nonobvious example where copying can be avoided is in 
Conway's
Game of Life:  when we calculate what cells live and die in the next
generation, we can actually use the 'Command' design pattern to avoid
making a temporary copy of the world.  We can talk about this in more
detail if anyone is interested.)
I am.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Lottery simulation

[Max Noel]

On Jan 5, 2005, at 16:33, ümit tezcan wrote:
Are there any starting ideas for me to get going on this project 
either thru the tutor or searching for snippets already created by 
fellow programmers??
	That's probably obvious, but you should proceed as follows:
- Generate a number for each person.
- For each week, generate a random number (the draw) and compare it to 
each person's number.
- If there is a match, do something.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Re: The Game of Life

[Max Noel]

	First of all, thanks for answering our questions, Danny! And sorry for 
the lag before my reply, but I was rather busy over the last few days 
(moving "back" to the UK).

On Jan 6, 2005, at 20:05, Brian van den Broek wrote:
I am having a hard time figuring out how to efficiently snip and 
comment, so please bear with any organizational issues. I think I will 
just preserve the parts relevant to what I want to talk/ask about and 
write at the end.
And I hereby massively SNIP whatever remained of it. :D
I gave some thought (though produced no code) to the question of how 
to do a life game before you posted your code. My naive approach 
differs a bit, and it seems to me better. I'd like to know why I am 
wrong ;-)

So, relying on your code unless differences specified (and, like you, 
not making it OOP, so having more passing of the world than I'd like, 
but I'm only just now groking the OOP way), I would have done 
something like the following. (Please be tolerant of any syntactic 
slips; I think and hope my aim is clear, if not the execution.):

1) Define world by filling an M by N matrix with True and False. 
Otherwise, as your step (1).

2) Define a print function which goes through the matrix, printing one 
thing for each True cell and another for each False cell.

3) Define the count_live_neighbours() roughly as you did. (The actual 
code below assumes your count function, modulo the change to it that 
you define a LIVE name and I am just using True.)

4) Define a "will be changed function" roughly as the untested code:

5) Define a get_changed_cells_list function (again, untested):

6) Define update_world function (again, untested):

I hope the fragmentary nature of this makes my intent clear.
Anyway, as I see it, this has the following advantages over your 
posted code:

1) Cell representations done with built-ins seems likely to be 
quicker. (A minor point, though.)

2) Use of booleans for cell contents makes the change cell procedure 
simply saying not
.> cell_contents  # as in for loop of my update_world().

3) Neither a copy of the world nor the design pattern is needed. 
Instead, I make a list of the cells to be changed. In the limit, where 
ever cell will change, this is no better than a copy of the world, but 
i) it often is better, and ii) I'm not sure the Life rules can create 
a world where every cell will change in the next generation, anyway.

I don't see any disadvantages, but then I don't see too well ;-)
	You're wrong in that you're not wrong. I'm not very familiar with 
design patterns yet, but to me, what you just described looks like 
another Life implementation using the Command design pattern. It is, 
however, more efficient and IMO elegant than Danny's.
	Correct me if I'm wrong (I may be talking out of, er, a certain part 
of my anatomy that is far from my mouth), but the basic idea of the 
Command design pattern is to store the changes to be made (instead of 
the post-change states) in a disposable data structure, then to apply 
them to the original copy of the world. Which should be more efficient, 
at least memory-wise. Right?

	Oh, the Life rules allow a world where every cell will change in the 
next generation, iff your world is a torus (i.e. the lower row 
"touches" the upper row as if it were immediately above it, and the 
right column "touches" the left column as if it were immediately left 
of it). It is quite trivial: set all cells to LIVE. Next generation 
they're all DEAD.
	If your world is a finite rectangle, I think the best you can get is a 
world where all but four cells (the corners) change next generation 
(same method). As your rectangle stretches to infinity, obviously, the 
cells changed/total cells ration converges toward 1.

In any case, your point still stands.
did you mean make the world a class (and thus avoid the sort of 
passing the world dict up and down as I did here?) Either way, a quick 
word or two will be great; I'm not asking for you to take the time to 
code it up for me :-)
Probably, but I don't think that's relevant.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Re: The Game of Life

[Max Noel]

On Jan 6, 2005, at 21:20, Brian van den Broek wrote:
Oh, the Life rules allow a world where every cell will change in 
the next generation, iff your world is a torus (i.e. the lower row 
"touches" the upper row as if it were immediately above it, and the 
right column "touches" the left column as if it were immediately left 
of it). It is quite trivial: set all cells to LIVE. Next generation 
they're all DEAD.
Topologist! (That's cheating!) ;-)
If we are going that way, you 'iff' seems a bit hasty. Take the 1x1 
matrix 'full' of live cells.
	Well, if the only cell of a 1x1 torus matrix is LIVE, that  means it 
is surrounded by 4 LIVE cells, doesn't it? :D

Also, other 'funny' (in the sense that a torus is funny) planes could 
be defined (say a torus-like structure with more than 1 whole -- 
cannot recall the general terminology from ill-remembered topology), 
etc. I meant the claim for a standard non-trivial (i.e. M > 1 and N > 
1) MxN euclidean plane matrix, but your correction is both amusing and 
welcome.
	Thanks :)
	However, the main reason why I talked about a torus is that it's one 
of the two obvious choices when you're implementing Life using a 2D 
matrix (the other being a finite rectangular plane).

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Slightly OT - Python/Java

[Max Noel]

On Jan 10, 2005, at 00:18, Liam Clarke wrote:
Hi all,
I've been forcing myself to learn Java, and I was wondering if
anyone's used Jython.
To clarify - Jython generates Java bytecode?
	I've also learnt Java in roughly 1 week last autumn, because that's 
what's used at the University of Leeds. All in all, it's a language I 
quite like, much superior to C++, although it does lack the elegance of 
Python and Ruby.
	I also found that the Swing API (for building GUIs) was remarkably 
easy to use. I can't compare, though, as I've never written GUI'd 
Python or Ruby programs (and if I did, I'd probably be using PyObjC or 
RubyCocoa anyway, so that'd be equivalent to using Objective-C).

All that stuff with typing variables - I can understand that you'd
want to specify when the compiler needs to reserve 64 bits for a long
integer, but beyond that is the typing really necessary for
performance reasons? As far as I can tell it's merely so that the
compiler can  check for errors which could lead to security problems.
Very frustrating. As is the true/false checking...
	Well, it has ups and downs... As you said, strong typing reduces the 
chances that a security problem will occur, and is slightly faster.
	Also, Java has something which Python lacks (yet should have): 
private/protected/public class members. In Python, everything is 
public, which I consider to be a Bad Thing(TM).

(Also very frustrating is having lists that can be comprised only of
one variable type.)
	First things first: don't use lists/arrays. Use Collections instead 
(classes like ArrayList, HashMap, etc.). They're much more versatile, 
and akin to lists and dictionaries in Python (sometimes even better). 
Iterators over them are supported.
	And while they can indeed only be comprised of one variable type as 
well, said variable type is Object, from which all classes derive, so 
that's not a problem (you only have to remember to cast as you get() 
something from a Collection).

(Why can't a non-static
method comparison be called from a static reference? What does that
mean anyway?
Er... What was your code like? (before and after correcting the error)
Runtime in Python 17.605 seconds (avg over 10 runs)
Runtime in Java 12.302 seoncds (avg over 10 runs)
	Does runtime in Java include startup? Every time you start a java 
program, it has to load a BIG runtime in memory (roughly 30 megs of 
classes -- that's both Java's curse and blessing).
	Also, this test is not a very good way to measure performance of both 
languages. Java really shines when you start going haywire with classes 
and objects -- and the program goes faster as it runs (thanks to the 
Hotspot JIT compiler, that optimizes and caches stuff in ways I don't 
really understand)

So yes - if Jython compiles to Java bytecode, and gives that 5 seconds
faster performance, but I write it in Python, and it gives me that 27
minutes of not messing about counting my braces, I'm in heaven. ( I
actually wrote a Python script to count braces.)
	Oh Ghost. You didn't actually write a Java program using a regular 
text editor, did you?
	Go and download Eclipse. Now.
	It's the best IDE in the world, and probably the main reason why I 
like Java. It has features you can't live without once you've tried 
them -- spellchecking with smart correction, auto-completion, pop-up 
help dialogs... And most importantly, code auto-formatting and 
automatic brace matching.
	And of course, it's free (and written in Java). http://www.eclipse.org

	I'm also told people are currently developing a Python plugin for 
Eclipse. That'd be the Best Thing Ever(TM).

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Modifying game of life

[Max Noel]

On Jan 10, 2005, at 17:53, Kooser, Ara S wrote:
Does anyone have an suggestions, explanations, websites? Thanks.
Ara

import random
perc = raw_input("Please enter a threshold between 0-1.  ")
raw_input("Press return to make a world")
PERSON, EMPTY = '*', '.'
def percolation(perc):
randval = random.random()
PERSON, EMPTY = '*', '.'
if randval > perc:
EMPTY
if randval < perc:
PERSON
	I think the problem is there. The function doesn't return anything. 
Chances are you should use "return EMPTY" and "return PERSON" instead 
of what you have right now (have you been using Ruby recently?).
	Also, the function still doesn't return anything when randwal == perc.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] More and more OT - Python/Java

[Max Noel]

On Jan 10, 2005, at 22:00, Liam Clarke wrote:
Hehe, I'm not up to collections yet... working through Learning Java
by O'Reilly.
	If you already know a bit about OOP, I would recommend that you read 
bruce Eckel's "Thinking in Java". An excellent book, freely available 
on-line (do a quick Google search), and it taught me in 1 week all I 
needed to understand my courses (which dealt with OO analysis and 
design, Swing GUIs and some ore advanced topics).
	A good follow-up to that would be McMillan & Wiggleswrorth's "Java 
Programming - Advanced Topics", through which I'm currently reading. It 
has some really good stuff, including things about XML parsing with SAX 
and DOM...
	I may actually be about to understand how to use SAX and DOM, w00t! 
(*prepares a bottle of Champagne*)

(Why can't a non-static
method comparison be called from a static reference? What does that
mean anyway?
Er... What was your code like? (before and after correcting 
the error)

it was (off top of head here)
public class dude
{
public static void main(String [] args) {
System.out.print(args[0]);
if (doComp(args[0]));
{
System.out.println(" is true");
}
else
{
System.out.println(" is false");
  }
private boolean doComp(String x) {
   int j = new int(x);   #I can't quite remember how I did
this precisely.
   if (j==1)
  {
  return True;
  }
   else
  {
   return False;
   }
 }
}
	Okay, I understand the problem, and it's quite logical once you know 
the reason.

	Basically, static methods and variables are class methods/variables. 
That is, they're bound to the class as a whole and not to any instance 
of it (in fact, they can be used without instanciating the class at 
all).
	Non-static members are instance members. They are bound to and act 
upon specific instances of the class. Thus, you can't use them before 
instanciating the class first.

So, if I have a class called Foo which has the following:
public static void bar()
public void baz()
	I can use bar() straight away, by calling Foo.bar().
	But if I want to use baz(), I first have to instanciate Foo, with 
something like Foo blah = new Foo(); and then call blah.baz(), which 
will then return whatever baz() computes based on blah's state.

	I guess that if you want your program to be wholly procedural, you 
need to make all your functions (methods) static, then.
	But if you're doing that, you're misusing Java. OO programming is 
where it shines.

I have no startup lag really.
	I stand corrected. But my other point is still valid -- see the Great 
Language Shootout Benchmarks for "better" (and customizable) language 
benchmarks.

*sigh* I have no net at home at moment, which is very frustrating when
I want to d/l documentation & editors. For the mo, it's all Notepad.
Ick.
	I feel your pain. Coding in any language is a chore with Notepad -- it 
comes down to whichever language requires the least (keyboard) typing 
being the least unpleasant to use. And Java, unlike Python, requires a 
lot of typing.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Fwd: [Tutor] Slightly OT - Python/Java

[Max Noel]

(*bangs head on keyboard* gah, I clicked Reply instead of Reply to All 
again -- sorry!)

Begin forwarded message:
From: Max Noel <[EMAIL PROTECTED]>
Date: January 11, 2005 00:09:11 GMT
To: "Alan Gauld" <[EMAIL PROTECTED]>
Subject: Re: [Tutor] Slightly OT - Python/Java
On Jan 10, 2005, at 20:04, Alan Gauld wrote:
Superior is a relative term. Java has lots of huge restrictions
compared to C++ - the lack of operator overloading being maybe
the biggest, since it prevents true sub typing of builtins and
primitives - thus resulting in extra(and horrible) code.
	Well, I've very rarely (if ever) used operator overloading, so I 
can't say I miss it much ;)
	However, you have a point in that I don't like the fact that 
everything is not an object in Java. Leftover non-object types from 
C/C++ (int, float, et al.) stand out like sore thumbs; however I can 
see how the lack of operator overloading prevents them from 
disappearing. I'm not sure how it works in Python, though; can you 
subclass int, list, dict, etc.? Does it have operator overloading, or, 
missing that, a way to extent operators into classes?

And the lack of functionpointers (inner classes not withstanding)
is a big hit, and what about multiple inheritance - interfaces suck!
	True, the lack of function pointers is a problem, at least when 
working procedurally. When going full-OO, I don't see where this can 
be a problem (since Class itself is an object, you can create pointers 
to classes).
	Also, I agree that interfaces are a bizarre way of adding multiple 
inheritance. I'm still wondering if there is a better way, though 
(apart from just allowing multiple inheritance, which I still don't 
know if it's a good idea or not).

Its also much slower - JIT compilers, and even native compilers,
notwithstanding. I could go on...but...
	Of course. I never suggested using Java to write 3D state-of-the-art 
games. For "standard" applications, though, it beats C/C++ any day of 
the week (worst-case scenario, you can still extend it in C, can't 
you? -- not sure about that).
	And a JIT compiler (HotSpot) is a part of standard Java now, isn't 
it? So I think it is relevant. (native compilers like GCJ, however, 
aren't -- they kinda defeat the whole point of Java if you ask me)

It is however, a simpler language to learn, and I must admit
that having got used to garbage collection in Python going
back top C and C++ is a shock... And the large standard library
(even if the design is awful in places) is an advantage.
Yup.
RubyCocoa anyway, so that'd be equivalent to using Objective-C).
Have you used Objective C itself? I like it a lot. It combines
much of what I like about both C++ and Python.
	Not yet. I tried learning it by myself last year, but the Cocoa 
framework, although extremely powerful, was a bit overwhelming to me 
(especially since I'd never done any real GUI programming).
	I'll probably give it another shot sometime this year.

Also, Java has something which Python lacks (yet should have):
private/protected/public class members. In Python, everything is
public, which I consider to be a Bad Thing(TM).
Why do you think it should have it? Have you run into a lot of
problems with inappropriate access in Python programs? This often
comes up from ex Java/C++ programmers yet access control like
this was not part of any of the earliest OOP languages and nobody
ever discussed it much(SMalltalk took one extreme - all data
private, and Lisp the other - all public) But I don't recall
have any big issues with lack of control, and I don't find
it an issue in Python.
What exactly do you find to be such a problem with the lack
in Python?
	Well, the fact that everything is public means that if you want a 
certain form of encapsulation, you have to state in the docstrings 
what should be used as an "external interface" (stuff like "This is an 
internal method and may change/disappear in the next version! Don't 
use it!") and hope that people who use your classes listen to what you 
say.
	I like the idea behind encapsulation, that you should be able to use 
a class as a "black box" with a known interface and not worry about 
the specifics. The way things are, Python gives you the possibility of 
shooting yourself in the foot; or to be more accurate they prevent you 
from preventing others from shooting themselves in the foot when they 
use your classes. (does what I say make any sense?)

	A solution would be to do like in Ruby, where class/instance 
variables have names starting with (respectively) @@ or @. I guess you 
can do the same in Python (although it'd be __ and _, I suppose), but 
the language doesn't enforce it.
(I know, I know, if I want Ruby, I know where to find it :p )

Does runtime in Java include startup? Every time you start a java
program, it has to load a BIG runtime in memory (roughly 3

Re: [Tutor] More and more OT - Python/Java

[Max Noel]

On Jan 11, 2005, at 01:38, Kent Johnson wrote:
Max Noel wrote:
A good follow-up to that would be McMillan & Wiggleswrorth's 
"Java Programming - Advanced Topics", through which I'm currently 
reading. It has some really good stuff, including things about XML 
parsing with SAX and DOM...
I may actually be about to understand how to use SAX and DOM, 
w00t! (*prepares a bottle of Champagne*)
If you are processing XML with Java you really owe it to yourself to 
learn about dom4j. Then you won't *have* to understand SAX and DOM, 
w00t w00t!
	dom4j? What is it? Is it part of the standard Java distribution? If 
not, where can it be found?

(thanks for the pointer, anyway ^^)
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] More and more OT - Python/Java

[Max Noel]

	dom4j? What is it? Is it part of the standard Java distribution? If 
not, where can it be found?
	Update: Okay, looks like it's time to go to bed. The link was in 
bright blue and somehow I didn't see it. D'oh.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] atof error

[Max Noel]

On Jan 11, 2005, at 20:25, Mike Procario wrote:
I got an unexpected error today using string.atof.
ValueError: invalid literal for float(): -17,019.797
To me -17,019.797 looks like a perfectly good floating point
number. I cannot find documentation on what the allowed range is.
	The problem is not the range. It's the comma that's right in the 
middle of the number. Yuck.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Fwd: [Tutor] More and more OT - Python/Java

[Max Noel]

(yes, forgot to CC the list again -- argh!)
Begin forwarded message:
From: Max Noel <[EMAIL PROTECTED]>
Date: January 11, 2005 23:33:44 GMT
To: Liam Clarke <[EMAIL PROTECTED]>
Subject: Re: [Tutor] More and more OT - Python/Java
On Jan 11, 2005, at 23:15, Liam Clarke wrote:
Out of curiousity, having poked around XML while learning about the
JScript DOM, what are you using it for?
AFAIK, you make up your own tags, and then parse them and display
them, and anyone else could create data using your tags.
Only thing I've seen that uses XML (remember I'm a n00bie in Python,
Java, Jscript and HTML, so I don't see the real indepth stuff) is MSN
Messenger for it's logs. And MS IE can parse that XML.
I've been curious as to how it's implemented.
So yeah, if you want to share your experiences.
Regards,
Liam Clarke
	Well, I plan to use it as a data storage format for a university 
project (crowd simulation in a shopping center -- coded in Java). I 
hate binary data formats, and XML is a good unified way to store data 
as ASCII text, so I figured I'd use it.
	Also, XML files can be parsed without too much work, so I can write 
scripts that will manipulate my data files, in any language ("any" 
meaning "Python", there).

	As a bonus, I've decided to have a look at XSL, which allows me to 
format a XML file for display in a web browser. It entirely changed my 
perception of web programming.
	I intend to program an on-line browser-based game with some friends 
of mine later in the year (in Python of course -- I converted them), 
and now that I've seen what XML and XSL can do, we're so going to use 
them for data output: the data is in dynamically-generated XML, which 
links to a (static) XSL stylesheet to tell the browser how to render 
that data.
	Doing things that way has many advantages:
1) Data is separate from formatting. That's always a Good Thing(TM). 
If I someday decide that I don't like the way the site looks, I 
theoretically only need to recreate a stylesheet, without touching 
anything else. (boom! Instant skins!)
2) Most of the "HTML rendering" is going to be done by the user's 
browser. This, and the way XSL stylesheets are constructed will 
prevent many bad HTML issues.
3) For the same reason, it will save bandwidth. The XML data will 
probably take less space than the fully-formatted stuff I'd have to 
spit out with "regular" HTML, and the XSL stylesheet can probably be 
cached by the user's browser.
4) In the same line of reasoning, it'll also save CPU time: XML data, 
being smaller, is generated faster than the equivalent HTML. Granted, 
the stylesheet is another server request, but it's static, so it puts 
virtually no load on a server.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge 
a perfect, immortal machine?"


--
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] More and more OT - Python/Java

[Max Noel]

On Jan 12, 2005, at 00:49, Guillermo Fernandez Castellanos wrote:
Does that mean that you use XML as a database to store data and make
queries, or that you store your information as XML in a database (as
MySQL)?
	Nope, nothing that fancy, I'm afraid. Just your run-off-the-mill "load 
from XML/save to XML" file operations.

I ask that because I'm writting a little program that will make
queries over a 1500 entries database, with very simple queries. I need
an answer in 1 or 2 seconds. I'm using SQLite now, but i wanted
something that depends as little as possible of external dependencies
(as a database).
	You should stick to SQLite. After all, it was designed exactly for 
what you're doing. Well, AFAIK at least.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] More and more OT - Python/Java

[Max Noel]

On Jan 12, 2005, at 01:40, Liam Clarke wrote:
So, you've got the XML like -
 You are standing in front of a stump. A path leads north. 

 N 

and you have a XSL that works like a CSS?
descript  {font:arial, align:center}
exits style:bolder
Is that a good paraphrasing? How browser dependent would that be? Do
most browsers support XML & XSL?
	Yup, that'd be the idea. IIRC most browsers support XML and XSL. (not 
sure, I'll have to check)

PS
What's SAX DOM? I know what a DOM is, but what's the SAX? I saw it in
my Python docs when I was poking XMLParser. If/when I work with XML,
would you recommend Python's standard modules for it?
	SAX is just another way of parsing XML. It's very sequential in 
nature, so it's not good if you need to re-access a previous node from 
the document, but since it doesn't load the entire document in memory 
(doesn't build a tree out of it), it uses less memory than DOM, and 
scales much better (obviously).

	I haven't tried Python's XML parsers yet, but I understand Python 
supports both SAX and DOM, so it should be okay...

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] spaces in print

[Max Noel]

On Jan 12, 2005, at 17:17, kevin parks wrote:

when i print:
print '\n','siday_q', key, '.wav'# event
i get:
siday_q 515 .wav
how can you eliminate the spaces to get:
siday_q515.wav
The quick and dirty way is to do:
print '\n' + 'siday_q' + key + '.wav'
The elegant way is to do use string formatting:
print '\nsiday_q%s.wav' % (key)
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] List comprehensions

[Max Noel]

On Jan 13, 2005, at 01:13, Bob Gailer wrote:
At 04:48 PM 1/12/2005, Kent Johnson wrote:
If you mean for j to be a list of foobar(item) then use
j=[foobar(item) for item in x]
The first part of the list comp can be any valid expression.
Does that mean that there are invalid expressions? I'd enjoy seeing an 
example.
Here's an obvious one:
j = [foobar(item)/0 for item in x]
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] List comprehensions

[Max Noel]

On Jan 13, 2005, at 04:13, Bob Gailer wrote:
I like Kent's response.
foobar(item)/0 is a "valid" expression. It fits the grammar of 
expressions. The fact that it raises an exception does not make it an 
invalid expression.

Consider foobar(item)/xyz. It is valid. If xyz == 0 then it will also 
raise an exception.
You have a point, I hadn't thought of it that way.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Faster procedure to filter two lists . Please help

[Max Noel]

On Jan 14, 2005, at 23:28, kumar s wrote:
for i in range(len(what)):
ele = split(what[i],'\t')
cor1 = ele[0]
for k in range(len(my_report)):
cols = split(my_report[k],'\t')
cor = cols[0]
if cor1 == cor:
print cor+'\t'+ele[1]+'\t'+cols[1]+'\t'+cols[2]
164:623 6649TCATGGCTGACAACCCATCTTGGGA   
484:11  6687ATTATCATCACATGCAGCTTCACGC   
490:339 6759GAATCCGCCAGAACACAGACA   
247:57  6880AGTCCTCGTGGAACTACAACTTCAT   
113:623 6901TCATGGGTGTTCGGCATGAAA   
	Okay, so the idea is, the first column of each row is a key, and you 
want to display only the rows whose key is the first column (key?) of a 
row in my_report, right?

	As Danny said, you should use dictionaries for this, with a structure 
in the lines of:

what = {'164:623': '6649TCATGGCTGACAACCCATCTTGGGA',
'484:11': '6687 ATTATCATCACATGCAGCTTCACGC',
'490:339': '6759GAATCCGCCAGAACACAGACA',
} (etc.)
	Lacking that, as Danny said, nested loops are a huge time sink. Also, 
you should avoid using C-style for loops -- Python-style for loops 
(equivalent to Perl's foreach) are much more elegant (and probably 
faster) in that case. Here's how I would do it with your data 
structures (warning, untested code, test before use):

# First, create a list where each element is one of the keys in 
my_report
# Also, strings have a split() method, which by default splits on any 
whitespace
# (tabs included)
headers = [element.split()[0] for element in my_report]

for element in what:
   # Okay, the nested loop is still (more or less) there, but it occurs 
within a
   # 'in' operator, and is therefore executed in C -- much faster.
   if element.split()[0] in headers:
  print element

	Also, it's shorter -- 4 lines, comments aside. Nevertheless, as Danny 
suggested, an approach using dictionaries would blow this away, 
speed-wise.

Hope that helps,
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Help

[Max Noel]

On Jan 10, 2005, at 14:31, john stanley wrote:
This is my first attempt at programing and my first program sort of 
did work hear is the program and if any one can tell me what i did 
wrong or forgot i would appreciate it


a = input("Type in the Grose: ")
b = input("type in the Miles: ")
print "a * 0.74 / b is" a*0.74/b
as you can see it should be realy easy program once it works
	The first thing to do is to look at the error that was caused, and 
what caused it. Python is good at it, as it shows you the exact line, 
and even the exact character where the error happened. Now, this 
example is trivial, but in the future, when you have such a problem, 
please include the traceback in your message, thanks.

	Anyway, the error happens in the last line, just before the last 
expression (a*0.74/b). Which is logical, because that expression is in 
no way linked to the string that's before it. I suppose you want to 
display the result of the expression right after the string, don't you? 
Then you might want to use the string concatenation operator: +
	It should be easy to correct, now...

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Objects, persistence & getting

[Max Noel]

On Jan 16, 2005, at 21:13, Liam Clarke wrote:
If I understand correctly, once an object is created, as long as
references to it exist, it isn't garbage collected.
	Correct, more or less (in the exception case where a references b, b 
references a but nothing else references either, both are GC'd if the 
implementation is sound).

So, if module a.py creates an instance of class foo, can method bar in
module b.py access foo without foo being passed directly to bar?
	Well, if you don't pass at least a reference to what you want the 
method/function to act on (assuming bar is not a method of Foo, of 
course -- or else, you should know that splitting the implementation of 
a class across multiple files, let alone modules, is a Bad Thing(TM)), 
how do you expect it to know?

Does that make sense? So, foo is floating around in the namespace, and
bar just wants to grab a field of foo. Can it? I had a poke around the
namespace yesterday, and got lost in hordes of methods that look like
__this__, which is ugly.
	Watch out, you seem to be confusing classes and objects, there.
	What are you trying to achieve there, exactly? Could you give us an 
example?

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Objects & Classes...

[Max Noel]

On Jan 17, 2005, at 20:51, Jack Cruzan wrote:
Ok, so each character has his name, race, his stats, his skills, and 
his
gear.

since the name and character is unique there is no need for a class
these things.
hmmm maybe I am conceptualizing this wrong.
would each new character then be a dictonary? Made up of different
elements or would the character be a list? Since each character is
basically just a list of stats... the stats get modified up and down by
race and certain gear... am I conceptulizing this correctly?
	I've thought about it a few times. Actually, when I learn a language, 
I often try to design and implement a SR character generator. Then I 
give up because it's really complicated and I don't have time (other 
things to do using the aforementioned programming languages, mostly :D 
).
	I'm probably gonna end up making a web-based one at some point, using 
either mod_python or Ruby on Rails. Gah, so many things to do, and so 
little time...

	Anyway, my view of the problem was that at least the following should 
be classes:
- Character
- Attribute
- Skill (perhaps a subclass: Specialization?)
- Augmentation (with subclasses like Cyberware, Bioware, AdeptPower)
- GearItem

	Character would mostly be a container for the other classes, so most 
of its attributes would be dictionaries, like:

class Character:
	def __init__():
		self.attributes = {'Body': Attribute(), 'Quickness': Attribute(), 
'Strength': Attribute(), 'Charisma': Attribute(), 'Intelligence': 
Attribute(), 'Willpower': Attribute()}

	Ah, things would be so much easier if McMackie would release the NSRCG 
source code (despite this abomination being written in Visual Basic), 
wouldn't they? ;)

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Objects & Classes...

[Max Noel]

On Jan 17, 2005, at 22:02, Chad Crabtree wrote:
(why would an attri bute need to be a separate class?)
	So that the points or Karma (depending on the generation system) cost 
of the Attribute can be calculated without having to resort to 
procedural programming.

	You'd be then able to get the Karma cost of all the attributes by 
using a line such as:

return sum([att.getKarmaCost() for att in attributes])
	The following is a preliminary Attribute class I dug up from my hard 
drive, made for the BeCKS creation system. Feel free to use bits of 
it...


#!/usr/bin/env python
class Attribute:
"""Shadowrun character attribute."""
def __init__(self, baseRating = 1, racialMod = 0, augCyber = 0, 
augMagic = 0):
"""Create an Attribute."""

# Initialize the class attributes...
self._baseRating = 1
self._racialMod = 0
self._augCyber = 0
self._augMagic = 0
self.setBaseRating(baseRating)
self.setRacialMod(racialMod)
self.setAugCyber(augCyber)
self.setAugMagic(augMagic)
def getRating(self):
"""Return the attribute's modified Rating."""
return self._baseRating + self._augCyber + self._augMagic
def getBaseRating(self):
"""Return the attribute's base Rating (unmodified by magic or 
cyber)."""
return self._baseRating

def setBaseRating(self, baseRating):
"""Set the attribute's base Rating. baseRating must be an int 
equal to or greater than max(1, 1 + racial mod)."""
if type(baseRating) != int:
raise TypeError, "Attribute rating must be an int."
if baseRating < 1:
# Attribute rating can't be lower than 1.
baseRating = 1
if baseRating < 1 + self._racialMod:
# Attribute rating can't be lower than 1 + racial mod.
baseRating = 1 + self._racialMod
self._baseRating = baseRating

def getRacialMod(self):
return self._racialMod
def setRacialMod(self, racialMod = 0):
"""Set the racial modifier for the attribute. racialMod must be 
an int."""
if type(racialMod) != int:
raise TypeError, "Racial modifier must be an int."
self._racialMod = racialMod
# Re-set the base Rating to enforce the racial limits
self.setBaseRating(self._baseRating)

def getAugCyber(self):
return self._augCyber
def setAugCyber(self, augCyber):
"""Set the cyber augmentation(s) for the Attribute. augCyber 
must be an int."""
if type(augCyber) != int:
raise TypeError, "Cyber augmentation must be an int."
self._augCyber = augCyber

def getAugMagic(self):
return self._augMagic
def setAugMagic(self, augMagic):
"""Set the magic augmentation(s) for the Attribute. augMagic 
must be an int."""
if type(augMagic) != int:
raise TypeError, "Magic augmentation must be an int."
self._augMagic = augMagic

def getKarmaCost(self):
"""Return the BeCKS Karma cost of the Attribute."""
rating = self.getBaseRating()
racialMod = self.getRacialMod()
minr = max(1, 1 + racialMod)
maxr = 6 + racialMod
if rating <= maxr:
# Could (will) be optimized for speed, but the formula is 
much clearer this way
cost = sum([2*i for i in range(minr + 1, rating + 1)])
else:
cost = sum([2*i for i in range(minr + 1, maxr + 1)]) + 
sum([3*i for i in range(maxr + 1, rating + 1)])
return cost


if __name__ == '__main__':
# Run a simple test procedure
atr = Attribute()
print atr.getRating()
atr.setRacialMod(1)
print atr.getRating()
atr.setAugCyber(1)
atr.setAugMagic(1)
atr.setBaseRating(3)
print atr.getBaseRating(), atr.getRating()
print 'Karma total cost', atr.getKarmaCost()
del atr

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] COP vs OOP (was: Objects, persistence & getting)

[Max Noel]

On Jan 17, 2005, at 22:41, Bernard Lebel wrote:
Alan Gauld wrote:
 In fact
I usually refer to Java as a Class Oriented Programming
rather than Object Oriented.

If you allow me a question
What is the fundamental difference between the two? To me this is not 
clear. I thought that a class was basically a programming object with 
properties and methods, but I never thought a class could not be an 
object.
	if you're only using static (class) methods, then your class 
can't/needn't be instanciated, and then is nothing more than the 
equivalent of a Python module. I think that's what Alan means by 
class-oriented programming.

	However, all the Java programming I've done so far has been true OOP 
(hopefully; it was for a Uni module called Object-Oriented Software 
Engineering), and I fail to see what in its design does not encourage 
this practice.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] COP vs OOP

[Max Noel]

On Jan 17, 2005, at 23:07, Bernard Lebel wrote:
Okay... so if I follow you, a class that has methods not part of 
itself, it's not a static class...? So should I understand that a 
class that gets inherited methods can be considered OOP?
	Not exactly. Basically, object-oriented programming is just that; that 
is, working with objects, which are instances of classes.
	Now, class methods/attributes, which I call "static" because that's 
the C++/Java keyword that triggers them, are methods and attributes 
that are shared by all the instances of that class, not specific to a 
particular instance. The class doesn't even have to be instanciated (no 
objects have to be created) for them to be used. They are effectively 
part of the class itself, hence the name, class methods (as opposed to 
instance methods).
	A common use for class attributes is to keep track of how many times 
the class has been instanciated (number of objects created).

	So, if my class only has static methods and attributes, any object I 
create with that class is empty: it has no attributes of its own, and 
is impossible to be interacted with. Thus, you could just as well say 
it doesn't exist, and that the class can't be used to create objects.
	Therefore, you're using a class to do procedural programming.

	However, the class has its separate namespace: when you're calling 
methods from that class from outside its body, the call syntax is 
Class.method(). Which is exactly the same thing as using a function 
from Python module.

I hope that answers your question...
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Objects & Classes...

[Max Noel]

On Jan 18, 2005, at 02:59, Jack Cruzan wrote:
Wouldn't it though! I haven't checked but doesn't he use xml for his
equipment lists - if that was the case it would be worth it to ask him
for those files 'eh?
	Last time I checked, he didn't. I have the DAT files here (extracted 
them off a Windows installation of the program) and have been trying to 
write a Python script that would convert them to XML.
	However, the file format is exotic and inconsistent (just like VB, 
some would say ;) ), so I haven't found a way yet to write an 
"universal converter": the script has to be modified for each file. I'm 
pleased neither with this solution, nor with the way my script looks: 
it's ugly.

	At some point, such a converter will have to be written, though, 
unless you want to go through the extreme pleasure of going through 1 
meg of text files by hand.


	Hmm, I really should try to start working again on this web-based SRCG 
idea of mine... The whole thing just screams "database". Daaargh, so 
many things to do, so little time. I suppose no good mod_python 
tutorials have spawned since last time I asked, right?

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Objects & Classes...

[Max Noel]

On Jan 18, 2005, at 03:46, Liam Clarke wrote:
Curious - what's mod_python?
	A Python module for the Apache web server, that among other things 
addresses the main shortcoming of CGI: mod_python (and mod_perl, 
mod_php and mod_ruby, for that matter) keeps the interpreter into 
memory (and as part of the server, so to speak). The server doesn't 
need to load and initialize a new interpreter each time a page is 
requested. This yields a tremendous speed increase (speaking in 
requests/second there, not in script execution time), and ensures that 
mod_python scales up *much* better than CGI.

http://www.modpython.org/
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Shadowrun programs

[Max Noel]

On Jan 18, 2005, at 17:52, Jack Cruzan wrote:
Greetings!
Ok if any of you read my earlier email you would have seen that:
	A) I am a newbie programmer.
	B) A Shadowrun gamer.
	C) In over my head making a SRCG (Shadowrun Character Generator)
so with that in mind gave up making my python based SRCG. Instead I am
making python Shadowrun utilities!
	The first of which was a program size and cost calculator for decker's
utilities and skillsofts. (I always hated flipping back and forth in 
the
book to figure it out). Thought I would let you see it and maybe
critique? Be kind its first original program I have written. (Well 
thats
not php or shell script).

	Doesn't look bad. However, you should aim to repeat yourself as little 
as possible, and the "The program's[...]" string is repeated 4 times. 
You should delay its display until the end of the program, like that:

if rating < 4:
availability = "2/7"
cost = rating * 100
# same for other options...
# [skipping to the end of the program]
print "The program's Availability is ", availability, " days and costs 
", cost

	Of course, an even better way is to use string formatting in the print 
line. But that's not really important.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] style question: when to "hide" variable, modules

[Max Noel]

On Jan 18, 2005, at 22:50, Kent Johnson wrote:
Python, instead, lets you change what attribute access means. The way  
to do this is with 'properties'. This is kind of an advanced topic,  
here are two references:  
http://www.python.org/2.2.1/descrintro.html#property
http://www.python.org/doc/2.2.3/whatsnew/sect- 
rellinks.html#SECTION00034
I have to admit, this is brilliant. Thanks for the pointer, Kent.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting  
and sweating as you run through my corridors... How can you challenge a  
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

[Tutor] A somewhat easier way to parse XML

[Max Noel]

Hi everyone,
	I've just spent the last few hours learning how to use the DOM XML API 
(to be more precise, the one that's in PyXML), instead of revising for 
my exams :p. My conclusion so far: it sucks (and so does SAX because I 
can't see a way to use it for OOP or "recursive" XML trees).
	I'm certain it can be used to do extremely powerful stuff, but as far 
as usability is concerned, it's ridiculously verbose and naming is 
inconsistent. I've had a look at Java DOM as well, and it's apparently 
the same.

	This afternoon, I read a bit about YAML and its basic philosophy that 
everything can be represented as a mix of lists, dictionaries and 
scalars. Now, setting aside the fact that one look at YAML made me want 
to ditch XML for data storage purposes completely (which I can't do 
since there's no Java YAML parser that I know of so far), it came to my 
mind once again that this is the one thing I want to be able to do in 
XML. Chances are that's all what 9 out of 10 programmers want to do 
with XML.
	In fact, I find it appalling that none of the "standard" XML parsers 
(DOM, SAX) provides an easy way to do that (yeah, I know that's what 
more or less what the shelve module does, but I want a 
language-independent way).

	So, to wrap my head around DOM, I set out to write a little script 
that does just that. Introducing xmldict.py and the DataNode class.
	For example, given the following XML file:




Body
6


Quickness
9


	...the DataNode class (yeah, I think I may have implemented that in a 
slightly bizarre fashion) will produce the following dictionary:

{u'attribute': [{u'@key': u'BOD', u'name': u'Body', u'rating': u'6'}, 
{u'@key': u'QCK', u'name': u'Quickness', u'rating': u'9'}]}

	As you can see, everything is represented in a mix of dictionaries, 
lists and unicode strings, and can now be used by a normal human being 
to write a program that uses this data.
	Comments, criticism, improvements, suggestions, [whatever]... Would be 
appreciated. Feel free to use it if you wish.

Thanks for your attention.



xmldict.py
Description: Binary data


-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] A somewhat easier way to parse XML

[Max Noel]

On Jan 19, 2005, at 03:58, David Rock wrote:
For me, it seems that the way you are supposed to interact with an XML
DOM is to already know what you are looking for, and in theory, you
_should_ know ;-)
	Indeed. The problem is, even if I know what I'm looking for, the  
problem remains that given the following document,


baz

	If I want to get "baz", the command is (assuming a DOM object has been  
created):

doc.documentElement.getElementsByTagName("bar")[0].childNodes[0].nodeVal 
ue

	Quoting from memory there, it may not be entirely correct. However,  
the command has more characters than the document itself. Somehow I  
feel it'd be a bit more elegant to use:

doc["bar"]
(or depending on the implementation, doc["foo"]["bar"])
Don't you think?
Still, I can't help wishing I had a simple way to create a dict from a
DOM. From a Python perspective, that seems more "Pythonic" to me as
well. I guess it's just a different way of looking at it.
	I can't help but think that from the perspective of any other  
language, that would feel more [language]-ic as well ;)

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting  
and sweating as you run through my corridors... How can you challenge a  
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

[Tutor] Importing multiple files as a single module?

[Max Noel]

Hi everyone,
	Having learnt OOP with C++, and most of my OOP experience being with 
Java, I'm used to storing my classes in one file for each class. I find 
it tidier and easier to read/debug.
	However, when I try to do the same in Python, each file corresponds to 
a module with a single class in it.

	Is there a way to obtain the same result in Python as in Java? That 
is, I'd like to have the following on my hard drive:

foo/
Bar.py
Baz.py
	Where Bar.py and Baz.py each contain a single class (Bar and Baz). 
Then, from Python, I'd import the foo module (import foo) and then 
access the classes with foo.Bar and foo.Baz (instead of foo.Bar.Bar and 
foo.Baz.Baz, which is what I have now). Being able to use Bar in Baz.py 
would of course be a nice side effect.

	Any ideas? Or am I trying to do things in a very non-Pythonic way? If 
so, how am I supposed to organize my OOP code, especially given the 
absence of a "real" IDE for Python?

Thanks for your attention,
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] read line x from a file

[Max Noel]

On Jan 22, 2005, at 13:53, Kent Johnson wrote:
That is the simplest solution. If your file gets bigger and you don't 
want to read it all at once, you can use enumerate to iterate the 
lines and pick out the one you want:

f = open(...)
for i, line in enumerate(f):
  if i==targetLine:
print line # or whatever
break
f.close()
	Of course, to do that, you must know the number of lines in the file 
beforehand. If you're running a UNIX system (Linux, OS X, *BSD...), 
that's easily done by calling the command "wc -l " (use 
os.popen to do that).

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] How would python messure up in performance?

[Max Noel]

On Jan 23, 2005, at 12:55, Kevin wrote:
How well would a multi user texed based game created in just Python
run if there were over 300 - 400 players (Just a hypathetical
question) Would python be to slow to handle that amount of traffic?
	It depends... What would be happening in said game? What would it 
involve, calculation-wise? What would you be running it on?

	In that kind of program, the core programming itself is rarely a 
bottleneck (IOW, Python should work just fine). The true elements on 
which your game's performance depend are:
1) Connection bandwidth and latency
2) Database access (especially if the DB is not on a remote server)
3) File I/O, if any

Could you give us a few more specs?
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] on the way to find pi

[Max Noel]

 This code gives the number in an unusual format like "3.1415'None'" 
it has a number part and a string part . I want to seperate these from 
easc other but I couldn't manage. I mean when I try to turn it into 
string format then try to use things like [:4] or like that they don't 
work.Any idea how to seperate this 'None' from the number and make it 
a real normal number on which I can do operations like +1 -1 or like 
that :)
Regards
	Well, you should try to have a look at where the "None" is appended to 
the string representing the number, and use a type check to decide 
whether or not you're appending/adding/whatever.

>>> type("abc")

>>> type(123)

>>> type(None)

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Print record x in a file

[Max Noel]

On Jan 23, 2005, at 22:08, Liam Clarke wrote:
Don't you mean
x=random.randint(0, lenoflist) ?? I'm assuming you want an integer.
	random.randrange() returns an item (which can be a float or whatever, 
but by default is an int) in the specified range. In that case, an int 
between 0 and lenoflist.
	The advantage over random.randint is that you can specify a step. Thus,
random.randrange(0, 257, 2) will return an even number between 0 and 
256 inclusive.

While although this code below does work many times
nothing is printed out.
import random
i = 0
while i < 10:
file = open('test.rantxt')
listcontents = file.readlines()
file.close()
lenoflist = len(listcontents)#-1
x = random.randrange(0,lenoflist)
print listcontents[x], i
i = i +1
	Anyway, the problem with this function is that len returns a number of 
items, but Python, like most good programming languages (and 
mathematicians), counts starting from 0. Thus, the first element in a 
list is foo[0].
	foo[len(foo)] will raise an IndexError.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] How would python messure up in performance?

[Max Noel]

On Jan 23, 2005, at 23:57, Kevin wrote:
Well not sure how to answer that but I will try. For file I/O you
would have a seperat file for each character that would store
HP/MANA/MOVE points, store items that the character would have on.
Areas would be loaded from there own files with all the creatures and
items for that area in the same file. Spells would probably have there
own seperate file to load from. As far as unning the game it would be
run on a redhat linux server.
	That's a bizarre design choice (for the characters, I mean), this just 
screams Database, especially since you may find yourself with 
concurrent write accesses on some files (e.g. a player attacks another 
while the other is moving).

	Anyway. This looks like you'll be doing lots of file I/O, with a few 
calculations inbetween, right? Then unless your server is really 
shitty, Python should handle this just fine.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] ascii encoding

[Max Noel]

On Jan 24, 2005, at 23:29, Luis N wrote:
How would I best turn this string:
'2005-01-24 00:00:00.0'
into this string:
'2005%2D01%2D24%2000%3A00%3A00%2E0'
In order to call a URL.
I've hunted through the standard library, but nothing seemed to jump 
out.
The pathname2url in urllib seems to do what you want:
>>> import urllib
>>> urllib.pathname2url('2005-01-24 00:00:00.0')
'2005-01-24%2000%3A00%3A00.0'
And urllib.url2pathname does the opposite conversion.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] sorting a 2 gb file

[Max Noel]

On Jan 25, 2005, at 23:40, Danny Yoo wrote:
In pseudocode, this will look something like:
###
hints = identifyDuplicateRecords(filename)
displayDuplicateRecords(filename, hints)
###

My data set the below is taken from is over 2.4 gb so speed and memory
considerations come into play.
Are sets more effective than lists for this?
Sets or dictionaries make the act of "lookup" of a key fairly cheap.  
In
the two-pass approach, the first pass can use a dictionary to 
accumulate
the number of times a certain record's key has occurred.

Note that, because your file is so large, the dictionary probably
shouldn't accumulation the whole mass of information that we've seen so
far: instead, it's sufficient to record the information we need to
recognize a duplicate.
	However, the first pass will consume a lot of memory. Considering the 
worst-case scenario where each record only appears once, you'll find 
yourself with the whole 2GB file loaded into memory.
	(or do you have a "smarter" way to do this?)

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] ascii encoding

[Max Noel]

On Jan 26, 2005, at 00:50, Luis N wrote:
Ok, urllib.quote worked just fine, and of course so did 
urllib.pathname2url.

I should have run a dir() on urllib. Those functions don't appear in
http://docs.python.org/lib/module-urllib.html
Now, how might one go about calculating the New York time off-set from
GMT? The server is in the U.S. but time.localtime() is giving me GMT.
	time.timezone gives you, I think, the offset between your current 
timezone and GMT. However, being myself in the GMT zone, I don't know 
exactly if the returned offset is positive or negative (it returns 0 
here, which makes sense :D ).

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] ascii encoding

[Max Noel]

On Jan 26, 2005, at 02:44, Tony Meyer wrote:
time.timezone gives you, I think, the offset between
your current timezone and GMT. However, being myself in the GMT zone,
I don't know exactly if the returned offset is positive or negative
(it returns 0 here, which makes sense :D ).
Whether or not it's positive or negative depends on which side of 
GMT/UTC
you are, of course :)  Note that the result in is seconds, too:
	Of course. What I meant was that I didn't know which "side" returns a 
positive offset (IOW, whether Paris (GMT+1) returns -3600 or +3600 -- 
it's the former, it seems).

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] ascii encoding

[Max Noel]

On Jan 26, 2005, at 02:56, Luis N wrote:
In other words I have to do some arithmetic:
import time
time.timezone
0
The server is located in Dallas, Texas.
	Which means it's not properly configured. On UNIX systems, to 
configure the timezone, you must adjust /etc/localtime so that it's a 
symlink that points to the appropriate timezone in /usr/share/zoneinfo 
.
	The exact layout of the /usr/share/zoneinfo folder is probably 
implementation-specific, but for example, here's how it is on my Mac OS 
X box:

[EMAIL PROTECTED] ~]% ls -l /etc/localtime
lrwxr-xr-x  1 root  wheel  33 25 Jan 18:58 /etc/localtime -> 
/usr/share/zoneinfo/Europe/London

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Should this be a list comprehension or something?

[Max Noel]

On Jan 26, 2005, at 03:17, Terry Carroll wrote:
My goal here is not efficiency of the code, but efficiency in my Python
thinking; so I'll be thinking, for example, "ah, this should be a list
comprehension" instead of a knee-jerk reaction to use a for loop.
Comments?
The point of the code is to take a sequence of objects, each object
representing an amount of water with a given mass and temperature, and 
to
return another object that represents all the water ideally combined.  
The
formulae for the combined mass and temp are respectively:

 combined mass = M1 + M2 + M3  (duh)
 combined temp = ((M1*T1) + (M2*T2) + (M3*T3)) / (M1 + M2 + M3)
Here's my code:

class Water:
def __init__(self, WaterMass, WaterTemperature):
self.mass = WaterMass
self.temperature = WaterTemperature
def __repr__(self):
return ("%.2f, %.2f" % (self.mass, self.temperature))
def CombineWater(WaterList):
totalmass=0
numerator = 0; denominator = 0
for WaterObject in WaterList:
totalmass += WaterObject.mass
numerator += WaterObject.mass * WaterObject.temperature
return Water(totalmass, numerator/totalmass)
Well, you can do this with list comprehensions, yeah:
totalmass = sum([WaterObject.mass for WaterObject in WaterList])
totaltemp = sum([WaterObject.mass * WaterObject.temp for WaterObject in 
WaterList]) / totalmass
return Water(totalmass, totaltemp)

	Doesn't seem that much more Pythonic to me. I find it about as 
readable as your code, but someone who isn't used to list 
comprehensions will find that weird-looking. However, someone who uses 
functional programming languages a lot (Lisp, Scheme, Haskell, ML...) 
will be familiar with that.

	The actual pros of that method is that it's a functional approach and 
that it has less lines than your approach (you can even reduce it to a 
one-liner by adding a third list comprehension, but at that point it 
starts to look ugly).
	As for the cons, as I said, it may seem less readable than the 
original version to the non-experienced; and chances are it's slower 
than the original version since it has to iterate through 4 lists 
instead of 2.

	In any case, when in doubt, do what you think will be easier to 
maintain.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] New to Python

[Max Noel]

On Jan 27, 2005, at 02:09, Jason White wrote:
I'm curious about good tutorial websites and books to buy.
	I learned Python (well, the basics thereof -- enough to do useful 
stuff on my summer job, anyway ^^) in an afternoon using the official 
tutorial that's found somewhere on http://www.python.org/ . It's very 
good provided you already have some programming experience (which seems 
to be your case).
	I hear that Alan Gauld's tutorial is also very good, but geared more 
towards people new to programming. You'll find the address in his sig 
(which itself should be in the post that he sent to the list while I 
was writing this one, if my predictions are accurate :p ).

I also have a development question for anybody who might know.  The 
project I'm working on now to develop my python skills is a prgram to 
script control another windows program.  The program doesn't have a 
published API so I'll probably need to locate memory addresses data 
fields and button routines.  Am I in way over my head for a Python 
beginner or does anybody have any advice for where to start poking 
around in memory and which python classes I should use to do so?
	Eeh? Peeks and pokes? Are you even allowed to do that? I mean, doesn't 
Windows have a protected memory mechanism, like any OS should have 
nowadays?

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Safely buffering user input

[Max Noel]

On Jan 27, 2005, at 18:17, Bill Mill wrote:
I've never used buffer(); in fact, I didn't even know it existed, and
I've been using python for a while now.
Instead of using buffer, just do:
sys.argv[1] = sys.argv[1][:255]
This says "Set the second element of sys.argv equal to its first 256
characters".
	Also, I don't think you have to worry about buffer overflows in 
Python, unless you're using a seriously broken implementation of it.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] carriage return on windows

[Max Noel]

On Jan 30, 2005, at 02:18, R. Alan Monroe wrote:

print "Percent completed:" + str(percent) + "\r"
Print forces a newline.
Try sys.stdout.write instead.
Alan
You can also use the following syntax:
>>> print "Percent completed:", str(percent), "\r",
	The trailing comma is NOT a typo, it is intentional. It prevents print 
from appending a newline.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] carriage return on windows

[Max Noel]

On Jan 30, 2005, at 02:40, Jacob S. wrote:
I don't think that's what he wants. I think he wants to *overwrite* 
what's in the shell with new output.
For example.

so that the whole line is overwritten. In my experience, this is not 
possible and if anyone can show me how to do it,
I would be grateful.

HTH,
Jacob
	It *is* possible, that's exactly what my code does (well, as long as 
you don't run it on Mac OS 9). The carriage return (\r, as opposed to 
the linefeed \n) moves the cursor to the beginning of the *current* 
line.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Presentation

[Max Noel]

On Feb 1, 2005, at 16:35, Paul Hartley wrote:
When I was a member of the Forth Interest Group in the USA we learned 
that Forth was used on the buggy that went to mars, that it started 
life controlling huge radio telescopes which only had 4k (yes 4k) of 
memory for both language and application.
 
Anything like the above concerning python would be useful.
	Well, that's probably not as awe-inspiring, but BitTorrent is written 
entirely in Python (with the wxPython graphical toolkit for the Windows 
and X11 versions, and PyObjC for the Mac OS X version). Google also use 
the language extensively, although I don't exactly know why, thanks to 
their obsession with secrecy.

	You could point out that Python's greatest strength (aside from its 
extreme readability -- unlike most people, The Whitespace Thing always 
struck me as an excellent design decision, although had I been Guido, 
I'd have forced the use of either tabs or spaces but not allowed both) 
is the fact that it's multi-paradigm. You can work procedurally, 
object-orientedly, and even in some cases functionally. And you can 
mix-and-match those 3 paradigms depending on your needs. This can be 
very useful.

	Oh, and make sure you mention iterators and list comprehensions at 
some point.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Classes

[Max Noel]

On Feb 1, 2005, at 23:08, Ismael Garrido wrote:
Hello.
I was just wondering, what magic can you do with classes? I mean, 
things like "class Name(Exception)" or "class Name(threading.Thread), 
which other classes are interesting to subclass? I've seen Object too, 
but I don't understand what it does.
	Basically, Object is the class all your classes should be deriving 
from (when you do that, you're using "new-style classes"). It's the 
root in the class hierarchy of Python. This gives you access to a lot 
of nifty features for free, such as properties.

Oh, and the best classes are those you create yourself, of course :D
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] how to separate hexadecimal

[Max Noel]

On Feb 2, 2005, at 10:19, Ewald Ertl wrote:
Hi!
Using binary operations:
a='0x87BE'
str(hex(int(a,16) & 0xFF))
'0xbe'
str(hex((int(a,16) & 0xFF00) / 0xFF))
'0x87'

HTH Ewald
Actually, the int conversions aren't even necessary.
>>> hex(0x87BE & 0xFF)
'0xbe'
>>> hex((0x87BE & 0xFF00) / 0xFF)
'0x87'
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Are you allowed to shoot camels? [kinda OT]

[Max Noel]

On Feb 2, 2005, at 23:18, Liam Clarke wrote:
1) I'll use Perl for the regex stuff from now on, Perl is obviously
built for this.
	Actually IIRC Perl *invented* regexes as we know them. The "standard" 
regex syntax is known as "Perl regex syntax".

2 ) There's More Than One Way To Do It makes debugging hard - i.e.
close INFILE; & close (INFILE); are both valid. I like one syntax, cos
it's easier to remember.
	I don't find it that bad. Ruby does it as well, and it's perfectly 
readable. It's more or less equivalent as if condition: and 
if(condition): both being valid in Python.

3) Some stuff is counter-intuitive -
$lenOfModList = @moddirList is the Perl equivalent of lenofModList =
len(moddirList)
	You sure of that? I was under the impression that len(moddirList) in 
Perl was $moddirList (@moddirList is the list itself).

Also, why doesn't if ( not $d eq "a" && not $d eq "c") evaluate to
true for $d = "b" when
if (not $d eq "a") evals to true and if ($d ne "a" && $d ne "c") evals
true also? What's with that?
	This probably has to do with operator precedence. It's been lifted 
from C, so chances are that && has a higher precedence than eq. Use 
parentheses.

4) WHAT IS WITH THE STUPID SYMBOLS EVERYWHERE LARRY??!!
I'm not referring to the $ & @, I can see how they could be useful,
although with a list -
@dude = (1, 2, 3), to obtain the 2nd value I would expect $d = 
@dude[1],
not $d  = $dude[1], that's counterintuitive also.
	This will be fixed in Perl 6. Then again, Perl 6 is supposed to be 
pure heaven, as the Parrot virtual machine can theoretically be used 
with any language and is heavily optimized. Python and Ruby with the 
speed of Perl, and the possibility to interface your code with CPAN 
modules. That's really cool.
	Once Perl 6 is released, of course.

Why is the read/write modifier part of the filename??? Why is it a > ?
In my opinion, there's only one place a > sign should be, in an
inequality test.
	This is consistent with UNIX redirection. ./foo > bar.txt executes the 
command foo, and redirects its STDOUT to the file bar.txt. ./foo >> 
bar.txt does the same, but appends to bar.txt instead f overwriting it.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Are you allowed to shoot camels? [kinda OT]

[Max Noel]

(damn, forgot to add the main part of my argumentation)
	I learnt Perl as well, a few years ago. It was the first scripting 
language I came across (all I knew before that were C, Turbo Pascal, 
and a few calculator programming languages), so I immediately fell in 
love with its string manipulation capabilities. I came across PHP a 
little while after, and while it had some things which I liked (PHP.net 
being the main one), I preferred Perl. However, I never got the 
opportunity to really use it, and after a while the inconsistency of 
the syntax grew on me, and the language itself kept eluding me. I was 
never able to grok it, and thus systematically reverted to C every time 
I had to code something.

	Fast forward to last summer. In the span of 1 week, I discovered both 
Python and Ruby. Fell in love with both and immediately ditched Perl. I 
never looked back, even though I know Perl is still the fastest 
scripting language around. I value debugging time more than CPU time 
these days.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Are you allowed to shoot camels? [kinda OT]

[Max Noel]

On Feb 3, 2005, at 00:42, Liam Clarke wrote:
I don't find it that bad. Ruby does it as well, and it's perfectly
readable. It's more or less equivalent as if condition: and
if(condition): both being valid in Python.
Yeah, but you'd never call a function foo like this-
 x = foo
in Python. It's just good to be able to say that a function always has
.
That improves readability (imao).
	Yes. That, and the fact that you can use function pointers very easily 
that way. For example,
x = foo
x()
will call foo. Which is cool.

	I do prefer the Python style as well. Just like variable naming 
conventions should tell you something about their nature, function 
calls should have something that explicitly gives them away as such.

MyClass
MY_CONSTANT
myVariable
myFunctionCall()
@mod = (1,2,3)
$mod = 3
$mod[0] = 1
Is inconsistent. Or at least, the logic behind this is not immediately
apparent to me. I'm always open to illumination on these things
however.
	Yeah. As with most things in Perl, there is no way to guess it. This 
is actually what I hate the most about that language, and what makes it 
write-only.

if ( not $d eq "a" && not $d eq "c") = False for $d = "b"
if ($d ne "a" && $d ne "c") = True

This probably has to do with operator precedence. It's been lifted
from C, so chances are that && has a higher precedence than eq. Use
parentheses.
Ah... Ironic, I got misled by TMTOWTDI. I figured that if not x=="a"
and not x == "c" evaled as True in Python, and "if (not $d eq "a")"
evaled as True in Perl, that
if ( not $d eq "a" && not $d eq "c") would also eval as true.
Of course, what's even weirder to me is that
if ($d ne "a" && $d ne "c") does eval as True, as far as I can see,
'$d ne "a"' is the same as d != "a" in Python, which is the same as
'if not d == "a"', which, logically, would mean that $d ne "a" is the
same as 'if(not $d eq "a") in which case both tests should handle the
addition of an AND the same.
	Again, no, because IIRC (it's been a while since I last used Perl) eq 
and ne are the Perl operators with the lowest precedence. In effect, 
your last statement is evaluated as if((not $d) eq "a").
	Use == and !=, they work on strings as well. Or (and?) use parens.
	Also, don't forget that Perl, like Python, uses lazy evaluation.

Once again, illumination is welcomed, as I have a finally that some
subtlety of Boolean logic is eluding me, and a 'x != a' test is
different to 'if not x == a' in a small but significant way.
Max - the foo > std.txt thing explains it, but what about @dude =
, where do the brackets originate from?
	I have no idea. Somehow I think it makes sense. It's one of the few 
things that I think make sense in Perl. Couldn't tell you why I think 
so, though :p

This is another issue I'm having with Perl as opposed to Python - Perl
is very much written by *nix users for *nix users, it's implementation
of *nix conventions shows, including the
`` things. Whereas (correct me if I'm wrong), but Python was written
by *nix users for everyone. Python seems very non-OS-denominational in
it's current incarnation, it may have been very *nix orientated prior.
	Not really. The thing is, Python in itself does very little. You have 
to import modules whenever you want to do something that involves the 
system (aside from file operations). That's an advantage IMO, since the 
default modules are quite good and allow for some nice cross-platform 
capabilities.
	However, if the redirection operators and pipes are what make you 
think that way, you should know that MS-DOS (and WinNT's DOS shell) 
does handle pipes and redirection. Perhaps not as powerfully as *NIX, 
but it does.

(however, I would appreciate it if the Python standard distribution 
came with a "real" XML parser, 'cause DOM and SAX just plain suck -- by 
the way, thanks guys, I tried dom4j on my Java project and it changed 
my life)

So here comes me, the guy who installed Linux once, failed to see the
big deal and uninstalled it. Up until 3 months ago, my comp was used
for gaming, pure and simple, me being a certified Day of Defeat freak,
and so Windows has always best served my purpose.
Now, I want to programme, so I have to learn Unix conventions to use a
crossplatform language!  It's like asking *nix users to sign a
Microsoft EULA!! (Well, not as bad, but still as anathemic.)
	Well, in Perl's defense, Windows does implement a fairly large part of 
the POSIX standard.
	And believe me. I'm a UNIX user (Mac OS X is my primary OS, but I also 
use Windows and Linux on a fairly regular basis). Perl doesn't make any 
more sense to me than when I was still a Windows-only guy.

How's Ruby? I bookmarked the homepage, but never got around to looking 
at it.
	Very, very nice. Cleanest object-orientedness I ever saw in a language 
(not that I have that much experience -- people like Alan would 
probably be better judges than me on this).
	I find it more elegant than Python, however I end up using Python 
anyway because Ruby has a huge flaw: it's Japanese (AFA

Re: [Tutor] Are you allowed to shoot camels? [kinda OT]

[Max Noel]

On Feb 3, 2005, at 09:48, Alan Gauld wrote:
Pythons lambda feature is a bare minimum (and Guido wants to remove
it!).
	Does he? Damn, just when I was learning functional programming! (in 
Haskell, if you're curious ^^)

Yes the Japanese thing is an issue.
THere are a few English books now, and the original one by Thomas
and Hunt is free on the web.
	A little bit outdated, however. Ruby lacks a proper series of O'Reilly 
books; last time I checked the only one available was "Ruby in a 
Nutshell", which is a few years old and covers Ruby 1.6 (2 versions 
behind the current one).
	What Matz needs to do IMO is to gather a couple of the l33test Ruby 
hackers in the world in a nice house in the Japanese countryside, pick 
a cool-looking animal (what about an eastern dragon?), and sit down 
with them to write a thousand-page "Programming Ruby".

 is a thing of beauty compared to Perl for OO!
In fact I actually don't mind VB OOP at all, especially in
its .NET variant which includes inheritance and polymorphism.
But Perl OOP is a hideous bodge.
	I haven't tried VB.NET (and don't intend to, I don't like BASIC-style 
languages), so I can't comment on this.

But unfortunately built very badly as an OOP environment. Its
more accurate to call it a class based language since its
perfectly possible to build a Java program with no objecs
but lots of classes! I'd go so far as to say that if you
followed Java's lead on OOP you would pick up some very
bad OO habits and write code that was not really very OOP
at all!
Thats not to say you can't write good OO code in Java just
that Java does little to encourage it. You need to read a
good OO book, like BRuce Eckels Thinking IN... series) to
see how to do it properly!
	Well, of course, it all depends on how you're learning it. I'm sure 
there are some C tutorials out there that teach you (and encourage you) 
to use GOTO statements. :-D

	Me? I learnt Java by reading Eckel's "Thinking in Java" (and then 
followed with Wigglesworth/McMillan's "Java Programming: Advanced 
Topics"). I agree with you: it's an excellent book, that encourages 
good coding style and proper OOP.

And whats worse is that there are few native code compilers
for Java. The JVM thing is a big hype factor IMHO. We've been
writing C/C++ programs for years that ran on Windows/Unix and
IBM boxes with only minor #ifdefs inserted. The performance
(and hence costs for servers!) differences are huge! Its no
coincidence that 2 of the biggest supporters of Java
(IBM and Sun) are hardware vendors!
	Agreed. I'm no compiler programmer, but it seems to me that they could 
just have written a nice cross-platform API and then platform-specific 
compilers, while keeping the specification of the language intact (i.e. 
platform-independent endian-ness, type sizes, etc.).
	The reasoning behind the JVM is that you don't need to recompile your 
code to run it on a different platform. But most existing Java projects 
have platform-specific versions, if only to make the GUI (try to) look 
native. You can spot a Java app from a hundred meters away.
	(then again, the same critic could be made of Python's and Perl's 
"standard" GUI toolkits)

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] got it

[Max Noel]

On Feb 3, 2005, at 18:17, alieks laouhe wrote:
So far I really like python...alot. it's so intuitive
I started trying to learn c but it's lack of intuitive
string handling made me shudder... so, i tried perl
and it was a breath of fresh air after c.
then i stumbled upon python. it's the most intuitive
yet.
	C is very good for a number of things (chief among those: speed). But 
string manipulation is definitely not one of them.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Are you allowed to shoot camels? [kinda OT]

[Max Noel]

On Feb 3, 2005, at 22:21, Smith, Jeff wrote:
Perl and Python both resist the introduction of a switch statement 
which
I (and many others) feel is the most elegant way to express what it
does.
I echo that.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Are you allowed to shoot camels? [kinda OT]

[Max Noel]

On Feb 3, 2005, at 23:19, Alan Gauld wrote:
Sean, what book/tutor are you using for Haskell?
I learned it from "The Haskell School of Expression" which
was OK but very graphics focused, I'd be interested in
recommended second source on Haskell.
	I'm not Sean, but I'm using Simon Thompson's "Haskell: The Craft of 
Functional Programming", which I find quite good. However, it's a bit 
odd, in that it almost reads like a mathematics book, which is 
something you may or may not like.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Are you allowed to shoot camels? [kinda OT]

[Max Noel]

On Feb 3, 2005, at 23:41, Jeff Shannon wrote:
(But then, at my job I'm stuck using a horrible Frankenstein's monster 
of a proprietary language on a daily basis, so I can't help but 
believe that there's plenty more awful languages around that didn't 
happen to be "rescued" from oblivion by an accident of history...)
	Yeah. Sometimes I read a little bit of Wikipedia's "Esoteric 
Programming Languages" page, and some of them just leave me in awe. 
Brainfuck (and its variant Ook!) and INTERCAL ("GOTO is considered 
harmful, so we removed it -- INTERCAL uses COME FROM instead") are 
already quite impressive, but the very idea of Befunge makes my brain 
want to explode. Especially that extension to the language that allows 
one to write N-dimensional programs. :D

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Are you allowed to shoot camels? [kinda OT]

[Max Noel]

On Feb 3, 2005, at 23:41, Alan Gauld wrote:
The reasons for the K&R style of brace winning is to do
with the way the brain process structure and despite
the subjects stated preference for the 'Pascal' style
they still had lower perception scores.
Little nit-picking here:
if(foo)
{
bar();
}
	Is not K&R style, but Allman style. K&R style (also known as One True 
Brace Style or 1TBS) is this:

if(foo) {
bar;
}
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] This Deletes All my Files

[Max Noel]

On Feb 4, 2005, at 06:39, Chad Crabtree wrote:
I've tried this and I cannot figure out why this does not work.  I
figure this has something to do with order of operations.  I figured
someone would know exactly why it doesn't work.  Wouldn't this start
inside parens then from left to right?
open(item,'w').write(open(item,'r').read().replace(' ',''))
I tried this on the shell just trying to do some quick text
replacement
because I could figure out how to get awk to do it, and I didn't want
to
spend 5 hours RTFM.  I got it to work by breaking it up to several
statements, but I would like to know.
	It's quite easy: evaluation starts from left to right. The program 
opens item for writing (thus deleting it), creating a file object, then 
executes its write method on the argument in the parens. However, since 
at that point item is now empty, there is nothing to read from.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Are you allowed to shoot camels? [kinda OT]

[Max Noel]

On Feb 4, 2005, at 09:09, Alan Gauld wrote:
Correct. The style you show (which I called Pascal style) is
the one that doesn't work. K&R style
if(foo) {
bar;
}

Is the one that won the shootout.
With the outsider(which I dont know a name for!) beating both...
if (foo)
   {
   bar;
   }
	According to the Jargon file, this one is called Whitesmiths style. I 
tend to use Allman style myself, but given the code completion, 
spellchecking, etc. in modern IDEs, I suspect it's become more a 
question of personal preference than anything else.

	A bit like if(foo) versus if (foo), and whether or not to use braces 
for single-line blocks. (the latter issue being why I think The 
Whitespace Thing is an instance of Best Thing Ever(TM))

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Hex to Str - still an open issue

[Max Noel]

On Feb 6, 2005, at 08:59, Liam Clarke wrote:
Ah, yeah, gotta get me one of those textbooks.
(Wait a minute, that would mean, my approach wasn't the textbook
approach... /me salvages a little pride.)
While I jest somewhat, that highlights a serious deficiency in my
education that becomes more and more apparent, which is in maths.
Sheesh, if I'd known I wanted to use maths for something I enjoyed, I
would've paid attention in class.
But the remainder thing - would this be why we read binary the way we 
do?

4 is 001 (on a continuum of 2^0 to 2^n), but using the above approach
we get 100.
Regards,
Liam Clarke
	Yes, it is 100. The most significant bit (i.e. the highest power of 2) 
is on the left, just as the most significant digit (matching the 
highest power of 10) is on the left when representing base-10 numbers: 
415 is 4*10^2 + 1*10^1 + 5*10^0.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: e-mail address change (was Re: [Tutor] python's default argument value handling in functions - weird syntax? problem grappling with the concept)

[Max Noel]

On Feb 10, 2005, at 03:07, Ismael Garrido wrote:
Danny Yoo wrote:
###
def f(a,L=[]):
   if L==[5]:
   print 'L==[5] caught'
   print L
   print 'resetting L...'
   L=[]
   L.append(a)
   return L
###
Now I'm dizzy... I can't understand why there are two "L"!
L is a local variable of the function, right? (I can't imagine it 
being anything else) Then if I reassign L to something, why doesn't it 
keep that change till next run? At least, it keeps the values in the 
list.. so it should keep the reassignation, no?
I'm completly puzzled :-S
	It's not L you have to look at but the default value itself. L is 
local to the function and recreated each time you run it. The default 
value, however (which has no name, so I'm gonna call it "defVal"), is 
static (in the Java/C++ sense of the word -- it's only created once). 
The first time you run the function, defVal is set to [] and then it is 
assigned to L (as in, L = defVal).
	Since defVal is a list, L and defVal are actually two names for the 
same variable. Thus, when you append something to L, it is appended to 
defVal as well. However, when you do L = [], you're binding the name L 
to another variable (which you create on the spot). But the name defVal 
is still bound to the same variable! Thus, when you run the function 
again, you get defVal as you left it.

# Let's consider that defVal == [5] (say, you've already called f(5)) 
and call f(10):
if L == [5]:		# L == defVal == [5] (they are the same variable)
	L = []		# Re-binding the name: a new var is created. L == []; defVal 
== [5]
L.append(a)		# L == [10]; defVal == [5].

See what I mean?
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Hex to Str - still an open issue

[Max Noel]

On Feb 10, 2005, at 05:43, Johan Geldenhuys wrote:
 I am not so clued up on the 'base 2' and 'base 8' stuff.
 Care to explain that a little?
	Usually, we use base 10 numbers, that is, numbers that can be 
represented with 10 symbols (0, 1, 2, 3, 4, 5, 6, 7, 8, 9).
	Binary, or base 2, represents all the numbers with only 2 symbols (0 
and 1), whereas octal (base 8) uses 8 (0 to 7) and hexadecimal (base 
16) uses 16 (0 to 9 then A to F).

In binary, 0b10 = 2, and 0b100 = 4.
In octal, 010 = 8 and 0100 = 64.
In hexadecimal, 0x10 = 16 and 0x100 = 256.
Is that clearer now?
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Perl Symbology (was: Are you allowed to shoot camels?)

[Max Noel]

On Feb 10, 2005, at 19:50, Bill Mill wrote:
so "#{} .
	Here, [symbol] refers to the scope(?) of the variable. See the 
discussion between me and Alan on this topic a while ago -- the use of 
these symbols being his main criticism of Ruby.

foo is a local variable
$foo is a global variable
@foo is an instance variable
@@foo is a class variable
FOO is a constant (which can be modded into global, instance or class 
with the appropriate use of $, @ or @@)

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] calling an external program

[Max Noel]

On Feb 14, 2005, at 10:37, Lobster wrote:
- I am trying to call up an external program
with something like a "Shell" command - can not find a way of doing 
this
(in windows)

Any hints?
What about os.system('your_command_here')?
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Problems with test cgi script on windows XP/Apache

[Max Noel]

On Feb 14, 2005, at 22:18, Liam Clarke wrote:
Windows, she is a woman, and woman are mysterious in their little
quirks. Unfortunately, you cannot divorce her, for she controls your
software and you really need DirectX if you want to play Sid Mier's
Pirates!
	Actually, you can find Atari ST and Amiga emulators for pretty much 
any system nowadays. :-p

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] newbie OSX module path question

[Max Noel]

On Feb 15, 2005, at 02:38, Mike Hall wrote:
Ok, I've got it working. The environment.plist file wants a path 
beginning with /Users, not /Local_HD. So simple!  Thanks everyone.
	Yeah, the system hard drive on Mac OS X (which is seen as "Macintosh 
HD", or in your case "Local HD" in the Finder) is mounted as the root 
of the filesystem. IOW, it's referred to as /, not /Macintosh HD.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] count words

[Max Noel]

On Feb 15, 2005, at 17:19, Ron Nixon wrote:
Thanks to everyone who replied to my post. All of your
suggestions seem to work. My thanks
Ron
	Watch out, though, for all of this to work flawlessly you first have 
to remove all punctuation (either with regexes or with multiple 
foo.replace('[symbol]', '')), and to remove the case of each word 
(foo.upper() or foo.lower() will do).

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Basic terminology

[Max Noel]

	In a slightly more generic fashion (everybody started dropping 
examples), the goal of an integer (euclidian) division (say, a / b) is 
to express an integer as such:

a = b * quotient + remainder
Where all the numbers used are integers, and 0 <= remainder < b.
	When you perform integer division in Python, a / b (a // b in 2.4+) 
gives you the quotient, and a % b gives you the remainder.

See the other posts for examples of use :p
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Queued threads

[Max Noel]

On Feb 16, 2005, at 01:58, Bernard Lebel wrote:
Now, I have a list of "jobs", each job being a windows bat file that 
launches an executable and performs a rendering task. So I have this 
queue of jobs, and would like to launch one only when the previous one 
has finished, and in a separate window. So far I have not been having 
much success with simple stuff:

from threading import Thread
def mainFunction():
print 'function print'
return 1
for i in range( 0, 3 ):
oThread = Thread( target=mainFunction ).start()
if oThread == 1:
print 'sleeping 3 seconds'
time.sleep( 3 )
In this example, 'sleeping 3 seconds' not returned, and each thread is 
started without any waiting.

I'm looking at the various threading module details in the library but 
I have to admit that, well, I'm a bit at loss here.
Okay, so basically, what you want to do is:
- Start the first bat file.
- Wait for it to finish.
- Start the second bat file.
- Wait for it to finish.
- Start the third bat file.
- Wait for it to finish.
	This just begs the following question: why are you even using threads 
to do that? This is perfectly sequential, with no element of 
simultaneity whatsoever...

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Queued threads

[Max Noel]

On Feb 16, 2005, at 02:36, Liam Clarke wrote:
I'm sorry, but when does oThread get the value 1?
If you're testing for it's existence via a True/False thing, try
if oThread:
But otherwise, I'm not sure what you're expecting to get.
	Once again, you hit the spot, Liam. It seems that a Thread object 
evaluates to False once it's terminated.
	That's probably what you're looking for, Bernard, my "threads won't be 
of any use here" argument notwithstanding.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Trivia program.

[Max Noel]

On Feb 16, 2005, at 10:26, . Sm0kin'_Bull wrote:
it prints like...
 
John GoodmanJohn GoodmanJohn GoodmanJohn GoodmanJohn Goodman
 
But i want to print it like...
 
John Goodman  John Goodman  John Goodman  John Goodman  John Goodman
 
How can I do it?
Try replacing the called = name * 5 line with:
if not name.endswith(' '):
called = ((name + ' ') * 5).strip()
else:
called = (name * 5).strip()
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Problem in making calulator

[Max Noel]

On Feb 17, 2005, at 23:11, . Sm0kin'_Bull wrote:
I wrote this to add 2 numbers...
print "Please input data"
number1 = int(raw_input(" "))
number2 = int(raw_input("+ "))
total = number1 + number2
print total
raw_input("")
I want to make output like this...
1 + 1 = 2
But, actually... it looks like this...
1
+ 1
2
	Do you really need to do it as the user enters the numbers? Aside from 
being a little bit confusing for him, it'd require playing around with 
bizarre special terminal control characters to go back one line -- 
every time the user hits Enter to validate his input, the newline 
character is echoed to the terminal and the cursor goes down one line.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] killing a thread

[Max Noel]

On Feb 22, 2005, at 23:08, Bill Mill wrote:
If I recall correctly, there is not a direct way. Instead, you're
going to want to have your worker thread check a queue it shares with
the parent every so often to see if the supervisor thread has sent a
"quit" message to it.
Peace
Bill Mill
bill.mill at gmail.com
	Using "direct" killing methods is not safe, because you never know at 
which point of its execution you terminate the thread. That's a Bad 
Thing(TM).

	So instead, the Right Thing is to implement an end() method in the 
object you're using as a thread. That end() method just sets a flag 
(say, isToTerminate) to True.
	Since the thread is running a loop, all you then have to do is have it 
check the isToTerminate flag at the beginning of each loop. If it's 
True, exit the loop (thus terminating the thread as it reaches the end 
of its run() method).

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Fwd: [Tutor] threads

[Max Noel]

Some day I'm actually going to learn how to hit the "Reply All" button. 
I swear.

Begin forwarded message:
From: Max Noel <[EMAIL PROTECTED]>
Date: February 23, 2005 18:42:37 GMT
To: Shitiz Bansal <[EMAIL PROTECTED]>
Subject: Re: [Tutor] threads
On Feb 23, 2005, at 17:50, Shitiz Bansal wrote:
Hi,
I am trying to build a traffic network simulator using
python, for my degree project.
I need to run at least 5-6000 cars simultaneously.I
wanted to run each car in a separate thread.
	Mmh... Sounds like a bad design decision to me. This doesn't scale up 
well, slows your system down to a crawl (especially if it's 
single-CPU), and some vehicles may never get to act if your OS doesn't 
have an efficient scheduler. Not to mention that due to the way 
threads are run, you probably won't ever get twice the same result 
when running a given simulation multiple times with the same 
parameters.

	Instead, you should fake it: have one thread running for all the 
cars. This thread has a for loop that iterates over all the cars and 
makes each of them "step".

	Coincidentally, I'm writing something that's more or less similar for 
my final-year project at Uni: a crowd simulation in a shopping center. 
I released the code under the GPL on Sourceforge (I've become a CVS 
addict), which you can find at http://sourceforge.net/projects/gmof/ .
	It's Java, not Python, but it's well-commented and written in a 
readable way (or at least I like to think so). Feel free to examine 
it. What you're looking for, I guess, is the run() method in the Mall 
class.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge 
a perfect, immortal machine?"


--
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] reading from stdin

[Max Noel]

On Mar 1, 2005, at 22:08, Nick Lunt wrote:
The way I did this was to use sys.stdin.readlines() to get the output
from the pipe.
Here is the program:
[code]
import sys, glob
args = sys.stdin.readlines() # found on the net
pat = sys.argv[1]
for i in args:
if (i.find(pat) != -1):
print i,
[/code]
My question is am I getting the output from the pipe in the correct
way ? The way Im doing it works (so far) but should I be doing it
another way ?
	I don't think you are. You're using readlines(), which means your 
program won't execute until ps terminates.
	UNIX philosophy is to have programs start acting as soon as possible 
-- in that case, as soon as the first line is available. You should be 
reading sys.stdin as an iterator (same thing you'd do for a file):

import sys
for line in sys.stdin:
# do stuff with that line of input
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Make a .exe

[Max Noel]

On Mar 4, 2005, at 09:26, David Holland wrote:
It Completed with these errors :-
The following modules appear to be missing {'AppKit',
'Foundation', 'objc']
	Now that's really weird. AppKit and Foundation are Mac OS X 
frameworks, and objc stands for Objective-C, the language in which 
they're written and which you're supposed to use to develop 
applications that use them.
	However, since you're on a Windows box, I have no idea why Python is 
trying to involve them.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] 2d list matrix 7 x 75 problem

[Max Noel]

On Mar 6, 2005, at 09:49, Dave S wrote:
so I thought I would be clever with ...
>>> a=[0]*5
>>> a
[0, 0, 0, 0, 0]
>>> b=[a[:]]*5
same problem.
It seems realy simple but how do I generate a 7 x 75 list matrix ?
Dave
Try this:
>>> a = [''] * 5
>>> b = [a[:] for i in range(5)]
>>> b
[['', '', '', '', ''], ['', '', '', '', ''], ['', '', '', '', ''], ['', 
'', '', '', ''], ['', '', '', '', '']]
>>> b[0] is b[1]
False

List comprehensions. Gotta love 'em... ^^
Is there a more elegant solution to
if string == 'sun' or string == 'mon' or string == 'tue' or string == 
'wed' or string == 'thu' or string == 'fri' or string == 'sat':
Yes, there is.
if a in ('sun', 'mon', 'tue', 'wed', 'thu', 'fri', 'sat'):
(also works with a list or a dictionary)
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] help

[Max Noel]

On Mar 7, 2005, at 16:46, Kent Johnson wrote:
Gregory Sexton wrote:
Thanks for the help! Sorry for the trivial questions, but I guess we 
all have to start somewhere.  Beginning python student, OS Windows 
XP,using Python 2.4.  Also novice to programming.  I cant get the 
"/a" command to work.
I don't know what the "/a" command is, please give more details.
	I find it extremely unlikely that Python, even in its Windows 
incarnation, support a "/a" switch, or any slash switch for that 
matter. Python is a UNIX program -- its switches start with one or two 
dashes, as the slash is the directory separator.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] HELP: subclass of int

[Max Noel]

On Mar 8, 2005, at 22:10, Shidai Liu wrote:
Hi all,
I'll sum up a question as following:
def int5():
'''return 5'''
return 5
class my_int(int):
def __init__(self):
self.id = int5()
int.__init__(self, self.id)  # FIXME: this line doesn't work
	I'm not absolutely confident with inheritance in Python (nearly all of 
my serious OO work has been in Java), but shouldn't the call to the 
superclass's constructor be the very first statement of the subclass's 
constructor?

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Acessing files in Windows 2000

[Max Noel]

On Mar 8, 2005, at 22:26, John Purser wrote:
Try c:\\my documents\\memo.txt
John
Or even better, c:/My Documents/memo.txt
	In most programming languages, you can use the slash as a path 
separator under Windows as well. It'll save you a lot of trouble.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Acessing files in Windows 2000

[Max Noel]

On Mar 9, 2005, at 01:13, Shitiz Bansal wrote:
Whats worse, I had found that the rule is different
for different versions of windows.Just proves what we
all know...Windows Suxx.
The Windows OS sucks!
And blows!
At the same time!
(name the reference, get a cookie ;) )
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] Terminology WAS Whats so good about OOP ?

[Max Noel]

On Mar 13, 2005, at 18:38, Brian van den Broek wrote:
Thanks for the explanation, Sean.
The reference to grammatical theory here does seem to make sense. But, 
relying on correspondence between the technical terms in 
programming/comp. sci. and other fields with similar terminology can 
get in the way, too.

I've a background in formal logic; it took me some effort to stop 
being upset that in Pythonic programming parlance get_a_random_element 
is a "function":


Where I come from, the output of a function is determined by the input 
to the function.
	Well, actually, your being upset at that is the exact point of 
functional programming languages: in functional programming, the output 
of a function is determined by its input, and *only* its input. 
Therefore, there are no side-effects (variables being one) calling a 
function twice with the same arguments will *always* yield the same 
result.
	The only time this paradigm is broken is (of course) when dealing with 
I/O.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] How do you use pydoc?

[Max Noel]

On Mar 15, 2005, at 00:28, [EMAIL PROTECTED] wrote:
   I have read but don't under stand how to use pydoc. here what i 
read can't figer out how to use it.
	pydoc is more or less a help browser. Think of it as "man for Python". 
If you need documentation on a module, just type "pydoc [module name]" 
at a command prompt. For example, if you want to know how the os module 
works, just type "pydoc os".

	Even better: if the modules you're writing use docstrings, then 
calling pydoc on your module will work automagically.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] what is the "path browser" used for?

[Max Noel]

On Mar 15, 2005, at 00:55, [EMAIL PROTECTED] wrote:
What is the path browser for and all the sys.path's for?
 are these for copying and pasteing to help you on your program?
	No, sys.path (as explained by pydoc sys ;) ) is the module search 
path; that is, the list of the folders into which Python looks for a 
module when you try to import it.

	Oh, and on an unrelated topic, could you please turn off HTML in your 
e-mails? Blue text on green background is not very comfortable to 
read... Thanks!

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] creating a tab delimited filename

[Max Noel]

On Mar 15, 2005, at 03:35, jrlen balane wrote:
how am i going to change the filename automaticaly?
for example:
#every 5 minutes, i am going to create a file based on the 
data above
 for i in range(100)
output_file = file('c:/output' +.join(i) +'.txt', 'w')
#guess this won't work
output_file.writelines(lines)
output_file.close()
	I'm not going to give you a complete solution because that'd spoil the 
fun, but you need to use the os.path.exists function (in the os 
module), which tells you if a file exists or not (no need to open it -- 
actually, your loop is dangerous: opening a file with "w" as the mode 
erases it).
	As for generating the file name, you've almost got it. Just remove 
that bizarre call to "join", cause that won't work, and replace your 
for loop with a while loop, so that you can break out of it when you've 
found the correct file name, not before or after.

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] re.findall vs. re.search and re.match

[Max Noel]

On Mar 15, 2005, at 16:44, Ron Nixon wrote:
Kent:
The code is below. Here's the error message.
Traceback (most recent call last):
  File "C:/Python24/reformat.py", line 5, in
-toplevel-
name = x.group(1)
AttributeError: 'list' object has no attribute 'group'
	re.findall returns a list object (as the error message says). Use name 
= x[1] instead. (and be careful, numbering starts from 0, so this code 
may contain a Kenobi error).

-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor

Re: [Tutor] re.findall vs. re.search and re.match

[Max Noel]

On Mar 15, 2005, at 17:41, Ron Nixon wrote:
Max:
Thanks that seem to do the trick. One question though,
how do you write a tuple out as a list to a new file
like the example I have in my code
Ron
	You mean, all the members of the list, separated by commas, with a new 
line at the end? Well, this may help you:

>>> foo = map(str, range(10))
>>> foo
['0', '1', '2', '3', '4', '5', '6', '7', '8', '9']
>>> print ",".join(foo) + "\n"
0,1,2,3,4,5,6,7,8,9
>>>
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting 
and sweating as you run through my corridors... How can you challenge a 
perfect, immortal machine?"

___
Tutor maillist  -  Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor