Aah! I understand now.
Thank you

Regards,
Krishna Mohan



On Mon, Jan 20, 2014 at 4:48 PM, Ben Finney <[email protected]>wrote:

> km <[email protected]> writes:
>
> > I am trying to find sub sequence patterns but constrained by the order
> > in which they occur
>
> There are also specific resources for understanding and testing regex
> patterns, such as <URL:http://www.pythonregex.com/>.
>
> > For example
> >
> > >>> p = re.compile('(CAA)+?(TCT)+?(TA)+?')
> > >>> p.findall('CAACAACAATCTTCTTCTTCTTATATA')
> > [('CAA', 'TCT', 'TA')]
> >
> > But I instead find only one instance of the CAA/TCT/TA in that order.
>
> Yes, because the grouping operator (the parens ‘()’) in each case
> contains exactly “CAA”, “TCT”, “TA”. If you want the repetitions to be
> part of the group, you need the repetition operator (in your case, ‘+’)
> to be part of the group.
>
> > How can I get 3 matches of CAA, followed by  four matches of TCT followed
> > by 2 matches of TA ?
>
> With a little experimenting I get:
>
>     >>> p = re.compile('((?:CAA)+)?((?:TCT)+)?((?:TA)+)?')
>     >>> p.findall('CAACAACAATCTTCTTCTTCTTATATA')
>     [('CAACAACAA', 'TCTTCTTCTTCT', 'TATATA'), ('', '', '')]
>
> Remember that you'll get no more than one group returned for each group
> you specify in the pattern.
>
> > Well these patterns (CAA/TCT/TA) can occur any number of times and
> > atleast once so I have to use + in the regex.
>
> Be aware that regex is not the solution to all parsing problems; for
> many parsing problems it is an attractive but inappropriate tool. You
> may need to construct a more specific parser for your needs. Even if
> it's possible with regex, the resulting pattern may be so complex that
> it's better to write it out more explicitly.
>
> --
>  \     “To punish me for my contempt of authority, Fate has made me an |
>   `\                   authority myself.” —Albert Einstein, 1930-09-18 |
> _o__)                                                                  |
> Ben Finney
>
> --
> https://mail.python.org/mailman/listinfo/python-list
>
-- 
https://mail.python.org/mailman/listinfo/python-list

Reply via email to