I am trying to find sub sequence patterns but constrained by the order in
which they occur
For example
>>> p = re.compile('(CAA)+?(TCT)+?(TA)+?')
>>> p.findall('CAACAACAATCTTCTTCTTCTTATATA')
[('CAA', 'TCT', 'TA')]
But I instead find only one instance of the CAA/TCT/TA in that order.
How can I get 3 matches of CAA, followed by four matches of TCT followed
by 2 matches of TA ?
Well these patterns (CAA/TCT/TA) can occur any number of times and atleast
once so I have to use + in the regex.
Please let me know.
Thanks!
Regards,
Krishna mohan
--
https://mail.python.org/mailman/listinfo/python-list