Your message dated Thu, 07 Feb 2019 13:20:24 +0000 with message-id <e1grjbm-0001hl...@fasolo.debian.org> and subject line Bug#919778: fixed in mash 2.1+dfsg-1 has caused the Debian Bug report #919778, regarding mash FTBFS on armhf when built on arm64 hardware to be marked as done.
This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 919778: https://bugs.debian.org/cgi-bin/bugreport.cgi?bug=919778 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
--- Begin Message ---Source: mash Version: 2.1-2 Severity: serious Tags: ftbfs https://buildd.debian.org/status/fetch.php?pkg=mash&arch=armhf&ver=2.1-2&stamp=1545838322&raw=0 ... dh_auto_test -a make -j8 test VERBOSE=1 make[1]: Entering directory '/<<PKGBUILDDIR>>' cd test ; ../mash sketch -o genomes.msh genome1.fna genome2.fna genome3.fna cd test ; ../mash sketch -r -I reads reads1.fastq reads2.fastq -o reads.msh Sketching genome1.fna... Sketching genome2.fna... Sketching genome3.fna... Bus error make[1]: *** [Makefile:94: test/reads.msh] Error 135 Backtrace: #0 0x00638d2e in MurmurHash3_x64_128 (key=0xf523a009, len=len@entry=21, seed=<optimized out>, out=out@entry=0xf6b2dbd4) at src/mash/MurmurHash3.cpp:277 #1 0x00635b4c in getHash (seq=<optimized out>, length=length@entry=21, seed=<optimized out>, use64=true) at src/mash/hash.cpp:23 #2 0x00639a50 in addMinHashes (minHashHeap=..., seq=0xf523a008 "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCAT"..., length=<optimized out>, parameters=...) at src/mash/Sketch.cpp:601 #3 0x0063a7d6 in sketchFile (input=0x692268) at src/mash/Sketch.cpp:1264 #4 0x006400a0 in ThreadPool<Sketch::SketchInput, Sketch::SketchOutput>::thread (arg=0xffeea370) at src/mash/ThreadPool.hxx:182 #5 0xf6cd2bbe in start_thread () from /lib/arm-linux-gnueabihf/libpthread.so.0 #6 0xf6bc94dc in ?? () from /lib/arm-linux-gnueabihf/libc.so.6 void MurmurHash3_x64_128 ( const void * key, const int len, const uint32_t seed, void * out ) { const uint8_t * data = (const uint8_t*)key; ... const uint64_t * blocks = (const uint64_t *)(data); ... key=0xf523a009 is not properly aligned for that.
--- End Message ---
--- Begin Message ---Source: mash Source-Version: 2.1+dfsg-1 We believe that the bug you reported is fixed in the latest version of mash, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 919...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Andreas Tille <ti...@debian.org> (supplier of updated mash package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA256 Format: 1.8 Date: Thu, 07 Feb 2019 13:36:30 +0100 Source: mash Binary: mash libmash-dev mash-doc Architecture: source Version: 2.1+dfsg-1 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team <debian-med-packag...@lists.alioth.debian.org> Changed-By: Andreas Tille <ti...@debian.org> Description: libmash-dev - development headers and static library for Mash mash - fast genome and metagenome distance estimation using MinHash mash-doc - documentation for Mash Closes: 918566 919778 Changes: mash (2.1+dfsg-1) unstable; urgency=medium . * Team upload. . [ Steve Langasek ] * debian/rules: set -DARCH_32 on our 32-bit architectures, as apparently intended by the code; without this, the armhf binaries will SIGBUS whenever running on a system that disallows unaligned access. Closes: #919778 . [ Andreas Tille ] * Remove code copy of MurmurHash and use libmurmurhash-dev instead Closes: #918566 * Do not run build time tests parallel * debhelper 12 * Standards-Version: 4.3.0 Checksums-Sha1: 70361819394a49d9ac9c75bb1e4aa91e8554d45d 2180 mash_2.1+dfsg-1.dsc 939d02bbbe3fff4434296662f3ce2403f9c1a419 3425776 mash_2.1+dfsg.orig.tar.xz 0e74777ee035e2778fcb9e94569581650b680874 2158856 mash_2.1+dfsg-1.debian.tar.xz Checksums-Sha256: c1581db3d4815692ee4f093bd662f51aa7a5de204d0c92ba167b46265a33595f 2180 mash_2.1+dfsg-1.dsc ebe1e30461cfc6b85b1a36e1c3efe92b4790b9060ada80b1c4502be84bca86ca 3425776 mash_2.1+dfsg.orig.tar.xz 8d38a64645d8ffc00bf5f8fcf03a90aea02d94c21bebdb4c5aaada00bdb414bb 2158856 mash_2.1+dfsg-1.debian.tar.xz Files: 4592c6e737c7190a6ea4d88afd0f25ca 2180 science optional mash_2.1+dfsg-1.dsc b7cb483e4aa3412035d837c4f6dd32b9 3425776 science optional mash_2.1+dfsg.orig.tar.xz 41adc3b60d457f2d743eb8ed42a8c147 2158856 science optional mash_2.1+dfsg-1.debian.tar.xz -----BEGIN PGP SIGNATURE----- iQJFBAEBCAAvFiEE8fAHMgoDVUHwpmPKV4oElNHGRtEFAlxcJ0oRHHRpbGxlQGRl Ymlhbi5vcmcACgkQV4oElNHGRtHOPw//R4xvy6Pqolaztiwj/2LqtxNNnXfarRnF khn+nLggZ3lnJC0bvq5I8x5njlblAw2F/3DwtkuCBPGMLvHKjWP2KIOJSbEfCa4R uuEE3KEi0fflj+rO544U27jfCWlD264ZJK9YOvlN0DRQ1xOLqQRJ6eVBPyvg1sHz W7l2SHYgHrnmLvRY2MEn//1ilfiweffiXOmMWS+O5vbD2YS5dJ30u5KysaVDNDZe O5zqQFOgC/ejevmYYGMkdf8rsa26rxY9GqSUy/FjgdqQ3ndC0Gzqp1/3+baGB4k/ o8QOX4UWN67O6O0Gj5G4Bempe1KeYh2IwZVtO2QxVorwr+CqZ4WwMVcrntMNABhF 73eDeC3gISfp9KCU97q3ZfxRfiouACSWxSAEA+uF/9Cc9gTUXdckk+D9CW+9NGNW YaWzsVy+LFhf3HNnDsva+QBFKxDm/GLfLeNUKCUXs53ZRw/twS/oR7ZVd45tzpiR 8ErAMiI5gpPaYDXyussGPlL5r86/EiQEyb+5rCjqJ7dqcQkQAXjRDQ35JUlOueW0 9J18C5HFIaaCJONfDqDuCVqoCuy74wSEDeZNNKc9MoVQqg95K9s0cX/wA6Ue+Jzk M2UUmRUjCCNAnI5WI5bT0Qg+M+2Yi73ejHq/M3MPgGA7ViqB8A1bf4rL/Mnakq2V gAuAPenr2+o= =Sk4F -----END PGP SIGNATURE-----
--- End Message ---
