Mike Robeson wrote:
>
> Hello,
Hello,
> I am a relatively new PERL beginner and have been trying to work with
> simple bioinformatics stuff. I have so far written some very useful but
> simple bioinformatics scripts. However.... recently I have been trying
> to work on a script to no avail. I have a text file whose contents are:
>
> >dog
> agatagatcgcatcga
> >cat
> acgcttcgatacgctagctta
> >mouse
> agatatacgggt
>
> .... and so on...
>
> I would like to turn that into this:
>
> a g a t a g a t c g c a t c g a - - - - - - - - - - - - - - -
> dog
> a c g c t t c g a t a c g c t a g c t t a - - - - - - - - - -
> cat
> a g a t a t a c g g g t t - - - - - - - - - - - - - - - - - - -
> mouse
>
> Notice that the sequence of letters varies however I need the lines in
> the newly formed file to be equal in length by adding the appropriate
> amount of dashes. For those in the know I am trying to convert a FASTA
> file into a DCSE file.
>
> I have been beating my head for the past 2 weeks and I cannot figure
> out how to do this. I do not expect a complete answer (I would like to
> try figuring this out on my own as much as possible) but rather some
> guidance. Any detailed pseudo-code would be appreciated!!
According to your data this should work:
#!/usr/bin/perl
use warnings;
use strict;
my $len = 30; # pad out to this length
while ( <DATA> ) {
unless ( s/^\s*>// ) {
chomp;
my @char = ( split( // ), ( '-' ) x ( $len - length ) );
$_ = "@char\n";
}
print;
}
__DATA__
>dog
agatagatcgcatcga
>cat
acgcttcgatacgctagctta
>mouse
agatatacgggt
John
--
use Perl;
program
fulfillment
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
