I am a relatively new PERL beginner and have been trying to work with simple bioinformatics stuff. I have so far written some very useful but simple bioinformatics scripts. However.... recently I have been trying to work on a script to no avail. I have a text file whose contents are:
>dog agatagatcgcatcga >cat acgcttcgatacgctagctta >mouse agatatacgggt
.... and so on...
I would like to turn that into this:
a g a t a g a t c g c a t c g a - - - - - - - - - - - - - - - dog
a c g c t t c g a t a c g c t a g c t t a - - - - - - - - - - cat
a g a t a t a c g g g t t - - - - - - - - - - - - - - - - - - - mouse
Notice that the sequence of letters varies however I need the lines in the newly formed file to be equal in length by adding the appropriate amount of dashes. For those in the know I am trying to convert a FASTA file into a DCSE file.
I have been beating my head for the past 2 weeks and I cannot figure out how to do this. I do not expect a complete answer (I would like to try figuring this out on my own as much as possible) but rather some guidance. Any detailed pseudo-code would be appreciated!!
-Thanks! -Mike
-- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
