In article <[EMAIL PROTECTED]>, Janek Schleicher
wrote:
> Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100:
>
>> I have a string that is a random sequence like the following:-
>>
>> ACGTCGTCGTCACACACACGCGTCTCTATACGCG
>>
>> I want to be able to parse the string, picking out any TATA sequences,
>> colour them in red and make a not of where ther lie in the sequence.
>>
>> Is this possible with perl?
>
> Yes, but you have to explain in what matter you want to colorize.
> As output in a terminal window, as html/xml, as a picture, as a word
> document ... .
>
> If you would have in a pseudo-xml with the tag <red>...</red>,
> you would perhaps do it as:
>
> $string =~ s/(TATA)/<red>$1</red>/g;
Here is my script using the regex substitution:
(I wonder if there is a way to report the starting char position for regex
matches like this?)
#!/usr/bin/perl
use warnings;
use strict;
# find_substring2
# I have a string that is a random sequence like the following:-
#
# ACGTCGTCGTCACACACACGCGTCTCTATACGCG
#
# I want to be able to parse the string, picking out any TATA sequences,
# colour them in red and make a not of where ther lie in the sequence.
while (@ARGV) {
my $sequence = 'TATA'; #what we are looking for
my $data = shift;
open FH, "< ", $data
or die "Couldn't open datafile $data for reading: $!\n";
while (<FH>) {
chomp;
print matches($., $_, $sequence);
}
}
# end main #
# begin sub #
sub matches{
my @matches;
my ($line_nbr, $line, $seq) = @_;
my $start_tag = "\e[31;1m";
my $stop_tag = "\e[0m";
$line =~ s/($seq)/$start_tag$1$stop_tag/g;
push @matches, sprintf "%5d : %s\n", $line_nbr, $line;
return @matches;
}
--
Kevin Pfeiffer
International University Bremen
--
To unsubscribe, e-mail: [EMAIL PROTECTED]
For additional commands, e-mail: [EMAIL PROTECTED]
