Opps double clicked first time round, I blame my mouse :-) Robin, perl has online documentation for all it's functions and much more. try the following
perldoc -f shift and perldoc perldoc for more general advice HTH "Rob Anderson" <[EMAIL PROTECTED]> wrote in message news:[EMAIL PROTECTED] > > "Robin Garbutt" <[EMAIL PROTECTED]> wrote in message > news:[EMAIL PROTECTED] > what does shift do in perl? > > cheers > > Rob. > > > -----Original Message----- > > From: Janek Schleicher [mailto:[EMAIL PROTECTED] > > Sent: 23 June 2003 08:52 > > To: [EMAIL PROTECTED] > > Subject: Re: perl reg exp problem > > > > > > Robin Garbutt wrote at Mon, 23 Jun 2003 11:40:47 +0100: > > > > > I have a string that is a random sequence like the following:- > > > > > > ACGTCGTCGTCACACACACGCGTCTCTATACGCG > > > > > > I want to be able to parse the string, picking out any TATA > > sequences, > > > colour them in red and make a not of where ther lie in the sequence. > > > > > > Is this possible with perl? > > > > Yes, but you have to explain in what matter you want to colorize. > > As output in a terminal window, as html/xml, as a picture, as a word > > document ... . > > > > If you would have in a pseudo-xml with the tag <red>...</red>, > > you would perhaps do it as: > > > > $string =~ s/(TATA)/<red>$1</red>/g; > > > > > > Greetings, > > Janek > > > > -- > > To unsubscribe, e-mail: [EMAIL PROTECTED] > > For additional commands, e-mail: [EMAIL PROTECTED] > > > > -- To unsubscribe, e-mail: [EMAIL PROTECTED] For additional commands, e-mail: [EMAIL PROTECTED]
