Please help. I have been search the internet to understand how to write a simple program/script with python, and I did not do anything. I have a file that look like this >ID 1 agtcgtacgt… >ID 2 attttaaaaggggcccttcc . . . in other words, it contains several IDs each one has a sequence of 'acgt' letters I need to write a script in python where the output will be, for example, like this > ID 1 a = 10%, c = 40%, g=40%, t = 10% >ID 2 a = 15%, c = 35%, g=35%, t = 15% . . . (i mean the first line is the ID and the second line is the frequency of each letter ) How I can tell python to print the first line as it is and count characters starting from the second line till the beginning of the next '>' and so on
Please help _______________________________________________ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: https://mail.python.org/mailman/listinfo/tutor
