X philosophy is to have programs start acting as soon as possible
-- in that case, as soon as the first line is available. You should be
reading sys.stdin as an iterator (same thing you'd do for a file):
import sys
for line in sys.stdin:
# do stuff with that line of input
-- Max
max
e-C, the language in which
they're written and which you're supposed to use to develop
applications that use them.
However, since you're on a Windows box, I have no idea why Python is
trying to involve them.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacke
;, '', '', ''], ['', '', '', '', '']]
>>> b[0] is b[1]
False
List comprehensions. Gotta love 'em... ^^
Is there a more elegant solution to
if string == 'sun' or string == 'mon' or s
or two
dashes, as the slash is the directory separator.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How can you challenge a
perfect, immortal machine?"
_
ne doesn't work
I'm not absolutely confident with inheritance in Python (nearly all of
my serious OO work has been in Java), but shouldn't the call to the
superclass's constructor be the very first statement of the subclass's
constructor?
-- Max
maxnoel_fr at yahoo dot fr --
On Mar 8, 2005, at 22:26, John Purser wrote:
Try c:\\my documents\\memo.txt
John
Or even better, c:/My Documents/memo.txt
In most programming languages, you can use the slash as a path
separator under Windows as well. It'll save you a lot of trouble.
-- Max
maxnoel_fr at yahoo dot fr -
On Mar 9, 2005, at 01:13, Shitiz Bansal wrote:
Whats worse, I had found that the rule is different
for different versions of windows.Just proves what we
all know...Windows Suxx.
The Windows OS sucks!
And blows!
At the same time!
(name the reference, get a cookie ;) )
-- Max
maxnoel_fr at yahoo dot
yield the same
result.
The only time this paradigm is broken is (of course) when dealing with
I/O.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How can you challenge
type "pydoc [module name]"
at a command prompt. For example, if you want to know how the os module
works, just type "pydoc os".
Even better: if the modules you're writing use docstrings, then
calling pydoc on your module will work automagically.
-- Max
maxnoel_fr
ython looks for a
module when you try to import it.
Oh, and on an unrelated topic, could you please turn off HTML in your
e-mails? Blue text on green background is not very comfortable to
read... Thanks!
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A patheti
p, so that you can break out of it when you've
found the correct file name, not before or after.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How can you challenge
;
re.findall returns a list object (as the error message says). Use name
= x[1] instead. (and be careful, numbering starts from 0, so this code
may contain a Kenobi error).
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, pan
On Mar 15, 2005, at 17:41, Ron Nixon wrote:
Max:
Thanks that seem to do the trick. One question though,
how do you write a tuple out as a list to a new file
like the example I have in my code
Ron
You mean, all the members of the list, separated by commas, with a new
line at the end? Well, this
On Mar 15, 2005, at 21:59, Liam Clarke wrote:
On Tue, 15 Mar 2005 17:09:50 +, Max Noel <[EMAIL PROTECTED]>
wrote:
re.findall returns a list object (as the error message says).
Use name
= x[1] instead. (and be careful, numbering starts from 0, so this code
may contain a Kenobi
l the
fun), but the range() function will generate a sequence of integers
depending on the parameters you pass to it (for example,
range(start=20, stop=100, step=10) will return [20, 30, 40, 50, 60, 70,
80, 90]). Then, you could use the sum() function.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #8527
cape context is a
Bad Thing.
Either way, it's better to use forward slashes (or os.sep if you're
going for overkill and/or obscure, non-POSIX platforms), with which
such problems just don't happen.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A
Forwarding to the list -- please use Reply to All.
Begin forwarded message:
From: jrlen balane <[EMAIL PROTECTED]>
Date: March 16, 2005 04:13:40 GMT
To: Max Noel <[EMAIL PROTECTED]>
Subject: Re: [Tutor] creating a tab delimited filename
Reply-To: jrlen balane <[EMAIL PROTECTED]&g
That's the fastest way I can think of -- but I can't prove it, as I
don't know how to use the timeit module.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run throug
)
t2 = timeit.Timer('primeConciseOptimized(5)', 'from __main__
import primeConciseOptimized')
t3 = timeit.Timer('primeConcise(5)', 'from __main__ import
primeConcise')
print t1.timeit(1)
print t2.timeit(1)
print t3.timeit(1)
-
On Mar 18, 2005, at 02:15, Kent Johnson wrote:
Max Noel wrote:
#!/usr/bin/env python
import math
import timeit
def primeConcise(limit):
return [2] + [x for x in xrange(3, limit, 2) if not [y for y in
[2] + range(3,x,2) if x%y==0]]
def primeConciseOptimized(limit):
return [2] + [x for x in
On Mar 21, 2005, at 12:57, Matt Williams wrote:
for i in range(len(y)):
y[i]="z"
print y
Surely there must be a better way than this ?
Sounds like a job for... list comprehensions! (cue cheesy superhero
music)
y = ["z" for i in y]
-- Max
maxnoel_fr at yahoo dot fr --
you with this email, so I can't really
help you much more than that.
Also, rename it. The str name is already used by a Python built-in
(namely, the string datatype).
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, pa
bject transform into an object of a different
class. You need to identify what class the object will be an instance
of before loading it. Which, if you're using XML tags like or , shouldn't be very difficult to do.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you
guess the maximum number of elements in a list is either (2^63 - 1) or
the available space in your computer's memory (RAM + swapfile),
whichever is the smallest.
In other words, enough that you don't have to worry about it.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Loo
On Mar 30, 2005, at 23:00, Kevin wrote:
I was wondering, can you make a program the uses alot of classes do
the exact same thing with out useing classes?
Yes. At some point, a program always has to be translated to machine
code to be executed by the processor. Machine language is not
object-orie
t:
myImage1 = Image("test.jpg") # Creates an image from the file "test.jpg"
myImage2 = Image() # Creates a blank image
Get the idea?
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone
you put the list you want to
sort against as the first argument to zip, all you have to do is to
then sort() the resulting list of tuples, and to "unzip" it, which
should be trivial.
>>> a = zip([3, 2, 1], [1, 2, 3])
>>> a
[(3, 1), (2, 2), (1, 3)]
>>> a.sort(
you should ask this one on the python-mac SIG mailing list:
http://www.python.org/sigs/pythonmac-sig/
Kent
You have to launch your script with pythonw, not with python.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
On Mar 31, 2005, at 23:07, Alan Gauld wrote:
And if Sun ever get round to finishing their JVM on a chip
we'll have a chip that is both OO and procedural!
At that point it would be a JRM, then, wouldn't it? :D
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacke
On Apr 1, 2005, at 00:14, Mike Hall wrote:
On Mar 31, 2005, at 12:21 AM, Max Noel wrote:
It's been too long since I used Python on MacOSX, but IIRC you can't
just run a Python GUI program from the shell. Or something like
that...you should ask this one on the python-mac SIG mailing
hould just work The default
sort will order the tuples by the first member...
Alan G.
What's the advantage of this compared to the "zip" method (which
yields the same result AFAICT)?
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic crea
oesn't exist yet, as the assignment hasn't happened yet. Therefore it
fails.
If foo existed before that line, it would work. Witness the following
example:
>>> foo = {'a':555, 'b':1}
>>> foo
{'a': 555, 'b': 1}
>>> foo = {&
and zfill:
>>> "xxx".rjust(10)
' xxx'
>>> "xxx".ljust(10)
'xxx '
>>> "xxx".zfill(10)
'000xxx'
Note that the string will not be truncated if it's more than (here) 10
characters long,
x27;t find it: there is
none. Python is an interpreted language (well, bytecode, but let's not
get into that, shall we?). To run your Python programs, you call the
Python interpreter on them: "python foo.py", for example, runs the
foo.py program.
-- Max
maxnoel_fr at yahoo dot fr -
al as a "real" quicksort
algorithm (like the one the list.sort method implements).
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How can you
Danny!
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How can you challenge a
perfect, immortal machine?"
___
Tutor mai
eatly appreciated.
Well, if you want b and a to refer to the same object, just use b = a.
Everything is a reference in Python, make use of this feature. (at that
point, I expect Alan to drop in and explain why what I said is not
entirely accurate, but good enough ;) )
-- Max
maxnoel_fr at yahoo d
- 100 is an integer. How, as a human being, would you define its
"length"? How many elements does it contain? It doesn't make sense,
does it?
Well, you have it. Numbers (ints, floats...) don't have a length.
Therefore, calling len() on an integer is a non-sense that result
recursion. You should do the same if you've got a few hours of
spare time, it's an enlightening experience. ^^
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through m
0 when x == y and 1
when x > y. it allows you to sort the list based on arbitrary criteria
without having to re-write a sort function.
If it is None, the default sort function is used.
I'm still using Python 2.3, so someone else will have to tell you what
the "key" argument i
ve my lazy arse and install it by hand.
Meh.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How can you challenge a
perfect, immort
nitely is my
favorite language. I can't wait to do some serious programming in it
(don't have enough time at the moment, with all the work I have to do
in Java... But as soon as Shadowrun 4 hits the stores, I'll start
working on a character generator, perhaps learning PyObjC in the
e gcc effort is at least 15 years old, yet
they're still finding ways to make it spit out faster code...
Which leads me to my next point: if you want your Python program to be
faster, rewrite the speed-critical parts (there aren't that many of
them) in C. That way, you can take advantage
e itself calls functions: the randint function from
the random module, and the built-in range function. (it also uses a
list comprehension, but that's another topic)
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
you also specify the encoding in the HTML your code generates?
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How can you challenge a
version))
>>> require((2,4,1))
Traceback (most recent call last):
File "", line 1, in ?
File "", line 3, in require
OSError: This program requires Python v2.4.1 or later
I'm not really sure what exception I should raise, though -- OSError
is the most
ative positions of the program and the WAV file -- it
looks like they should be in the same directory in order for the
program to work.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run
sourceforge.net/projects/mysql-python . Chances are it's a
standard distutils module, i.e. you install it with "sudo python
setup.py install".
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as
erstanding right the language
(ENGLISH) of the link you attached
Wherever you want, it doesn't matter. When you run "python setup.py
install", the module is installed in the Python standard library, so
once you've done it, you can delete the files.
-- Max
maxnoel_fr at yahoo do
ou are. So yes, it can be done, and quite easily at that
(although not as easily as in Ruby, IIRC, whose metaprogramming
features truly frightened me last time I had a look at it).
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat an
ection the program establishes to the
DB).
Storing clear-text passwords would be terrible from a security point of
view, since some people, despite being warned, use the same password
for
everything that they do.
I think you can safely s/some/most/ on this one :D
-- Max
maxnoel_fr at yahoo dot
) but still does a good job, and I hear autopackage isn't
bad.
Also, there was a project at some point that aimed at making Linux
applications into self-contained "executable folders" (like .app
bundles in Mac OS X). I don't remember the name, but I recall Rox-filer
stall them.
In order to install modules that aren't entirely written in Python
(such as this one, I wager), you need a working C compiler and standard
library.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and
due soon... I hate those :( ).
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How can you challenge a
perfect, immortal machine?"
___
On Apr 21, 2005, at 00:19, D. Hartley wrote:
Max -
I thought it might be a version issue as well, thanks. Also, good
luck on your paper! 50 pages, whoo! Haven't done that since grad
school, my condolences man.
~Denise :)
Thanks... I'm almost done now, only a few more pages and all tha
(functionFromMain):
functionFromMain()
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How can you challenge a
perfect, immortal ma
x27;t had the
occasion to use it yet, but it seems like an instance of Best Thing
Ever(TM).
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How can you challenge a
perfect
what
you want.
#!/usr/bin/env python
while True:
print "yo."
onceMore = raw_input("Once more?").strip().lower()
if "no".startswith(onceMore):
break
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature o
ose of this program (other than
learning more python) would be to actually help me study for a test,
so I would need to be able to save the information somehow. Any ideas?
The shelve module seems to be what you're looking for.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Loo
highlighting the instruction about to be executed makes
more sense to me.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How can you challenge a
perfect, immortal mach
ng.join method -- joins a list or tuple of strings. Example:
'xx'.join(["foo", "bar", "baz"]) returns "fooxxbarxxbaz".
- string formatting. You ever programmed in C? It's basically the same
thing as printf, only better. Example:
"Hi, my na
[Forwarding to the list. Please use "Reply to all", not "Reply", if you
want your reply to a message to go to the list]
Begin forwarded message:
From: "D. Hartley" <[EMAIL PROTECTED]>
Date: April 27, 2005 01:36:26 BST
To: Max Noel <[EMAIL PROTECTED]>
could start by modifying your for loop so that it reads like this:
for score, name, posY in mylist, range(270, 540, 30):
The rest shouldn't be hard to figure out. ;)
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, pant
. In fact I have
never built an industrial size OO system yet that did not use meta
classes somewhere in the design...
Speaking of that, would you happen to know a good
tutorial/introduction to metaclasses in Python?
-- Max
"Metaclass is an instance of one of its own subclasses." It&
I have one process for each user to check the database at the
same time is checking other users
This sounds like it'd be better done as a cron job (man cron for more
info).
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, p
in essence, what you're trying to do is store the output of a
command in a variable, right?
You might be interested in the os.popen family of functions.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweatin
string, and use this
string as the name of the file. The raw_input function should allow you
to do that.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How can you chall
Begin forwarded message:
From: Joseph Quigley <[EMAIL PROTECTED]>
Date: April 29, 2005 17:16:22 BST
To: Max Noel <[EMAIL PROTECTED]>
Subject: Re: [Tutor] cPickle (Joseph Q.)
I tried that and it doesn't work!
I type the name and it just sits there!
Here's the code:
# v
guilty of plagiarism, but also in
violation of the GPL.
Hope that helps,
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How can you challeng
ot; is and why
it's stupid, dangerous and illegal.
Yeah, I guess that's why I'm not a teacher :D
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating a
> example is something like:
>
Actually, cron has a resolution of one second, so it may still
be useful.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How c
o keep the connection up, just so that we
> pay
> the cost of startup just once.
>
Good point. Of course, that also involves keeping it alive by
sending NOPs every once in a while when there is no activity.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at y
supposed to be a Python Compiler. The programs are said
> to run
> faster than normal Python and they almost run as fast as C.
It's not a compiler. It's a JIT (Just-In-Time) compiler, a
little bit like HotSpot for Java.
Also, while it is faster than regular Python, it is s
On May 5, 2005, at 00:53, [EMAIL PROTECTED] wrote:
> As seen on python-announce (via Dr Dobbs):
>
> http://www.pythonchallenge.com/
>
> Good fun!
>
Very interesting indeed! I'm stuck on number 7, though -- looks
like it requires the use of PIL, which I'v
x27;: 2}
>>> a
{'foo': 1, 'bar': 2}
>>> a['baz'] = 'boo'
>>> a
{'baz': 'boo', 'foo': 1, 'bar': 2}
>>>
Interactive Python is your friend ^^.
-- Max
maxnoel_fr at yahoo dot f
~Denise
The goal for each riddle is to use the clues found on the page
and in its source code (together with some Python bits) to find the
URL (page name) for the next one.
So the question you have to ask yourself is, what do you see on
the first page that could be a clue?
-- Max
max
processing tool available for any language. In other
words, try to remember what you'll learn about them: they're very
useful.)
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through
with
regular expressions: they use a lot of backslashes, so use raw
strings in order not to have to escape them all.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... H
I'm not gonna be able to use a workaround this
time.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How can you challenge
a perfect, immortal machine?"
_
e to apply this thing?
It's elsewhere in the page's source code... Look carefully.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my
involving a certain
program by Adobe and lots of mouse clicks. Yes, you can laugh at me now.
> but it's just a few lines of Python code using PIL
> once you know what you're after.
Could you send me the code you used? (off-list, we don't want
any spoilers here, do we?)
ke. There's something in the big picture that I'm not getting
> here, I think.
If you've found the target file, saved it to your hard disk,
used the module on it and it says "file not found", I suspect there's
something wrong with your computer. If it was th
gt; first thought was i needed to use the module to do that. but
> apparently i need to use the module AFTER i get the file onto my hard
> disk? sorry to be so dense, i just dont get it.
>
Just enter the file's URL into your browser's address bar.
-- Max
maxnoel_fr at yahoo d
', 'z', 'a']
What I'd like to do is take my list and turn it into a
string, which looks neater when printed.
I've tried using join() but that didn't work, can
anyone give me a pointer here?
the other method I've used was dealing with a string
7;, '-', '/']
while True:
yield statusChars[index]
index = (index + 1) % 4
As for how to access it, use a for loop (for i in
neverEndingStatus()). xrange, for example, is a generator function.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274
ease provide an example of how my Test1() function
> changes based
> on your suggestion? (sorry to be dense)
>
Try the following code:
for i in neverEndingTest():
print i
breaking out of the infinite loop is left to the reader as an
exercise ;)
-- Max
maxnoel_fr at
On May 7, 2005, at 13:17, John Carmona wrote:
> Hi to everybody reading this thread, can anybody point me to the
> URL where I can find these challenges. Many thanks
>
> JC
>
http://www.pythonchallenge.com/
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Loo
On May 7, 2005, at 15:06, Max Noel wrote:
> Try the following code:
>
>
>
> for i in neverEndingTest():
> print i
>
Sorry, i meant "for in in neverEndingStatus()" (not
neverEndingTest()), where neverEndingStatus is the function I gave as
an e
that is not what I
> want!
>
The banner in question is the UNIX program "banner". Try running
a search on "UNIX +banner". Also, the theory of Run-Length Encoding
may come in handy for this part of the challenge.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
&qu
return i
... else: return 0
...
>>> b = [f(i) for i in range(10)]
>>> b
[0, 0, 2, 0, 4, 0, 6, 0, 8, 0]
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as y
namespaces are an instance of
BestThingEver.
By the way, it looks like your code induces an endless recursion
in an attempt to emulate GOTO statements (been programming in a
variant of BASIC?). That's a Bad Thing.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you
t;]
Yeah, used that way it pretty much does the same thing as getinfo
(), but I think it's more Pythonic (using a getinfo method feels Java-
ish).
Hope that helps,
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, pa
On May 11, 2005, at 07:23, Liam Clarke wrote:
> Ack, banner.p eh?
>
> Can anyone explain the significance of the numbers? Are they columns?
>
> Regards,
>
>
> Liam Clarke
As I said, read about Run-Length Encoding.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
e a look
at the first 2 characters of the string, which if I recall are
printable, and should point you toward the module you have to use to
solve that one.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating
On May 12, 2005, at 02:22, D. Hartley wrote:
> Max - yep, and the hint was "BUSY" (... BZ...)...
>
> Unfortunately that hint doesnt lead me anywhere (except to bz2, which
> involves compression, and didnt seem very likely).
>
> I went through and removed all
On May 12, 2005, at 02:42, Tony Meyer wrote:
>>
>> From the email address, chances are that this was a New Zealand
>> cultural
>>
> assumption. Ah, the French, lumping all English speakers under the
> American
> banner .
Touché. :D
-- Max
( What m
my hard drives,
written with edit.exe or e.com)... It gets very messy, very quickly.
> Will a standard xterm display chr(130) as é in linux for you, Max?
> Or under Mac
> OS X?
I just made a few tests. So far, it seems that it depends on the
character encoding in use:
- If it
p farther?
>
> Thanx,
> Jacob
>
Have a look at the source code of the "peak hell" page.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as you run through my corridors... How
t".strip
("atgc")
'SCER ATCGATCGTAGCTAGCTATGCTCAGCTCGATC'
Combining those 2 pieces of advice should solve your problem.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hacker... A pathetic creature of meat and bone, panting
and sweating as y
return
value of the executed process (that is, 0 if everything went okay).
For what you want to do, one of the os.popen* functions is what
you're looking for.
-- Max
maxnoel_fr at yahoo dot fr -- ICQ #85274019
"Look at you hack
101 - 200 of 296 matches
Mail list logo
