[Tutor] problems with numbers in my python code

Basically, I have a code with is almost finished but I've having difficultly with the last stage of the process. I have a program that gets assigns different words with a different value via looking them up in a dictionary: eg if THE is in the writing, it assigns 0.965 and once the whole passag

[Tutor] Analysing genetic code (DNA) using python

I have many notepad documents that all contain long chunks of genetic code. They look something like this: atggctaaactgaccaagcgcatgcgtgttatccgcgagaaagttgatgcaaccaaacag tacgacatcaacgaagctatcgcactgctgaaagagctggcgactgctaaattcgtagaa agcgtggacgtagctgttaacctcggcatcgacgctcgtaaatctgaccagaacgtacgt gg