I need help on the problem stated below.
Given a URL, open the webpage and return the first anchor link url (a href).
def extract_url_link(url):
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
https://mail.python
def save_url_to_file(url, savefile):
This is the starting code.
> On December 13, 2018 at 11:56 AM Sammy Lee wrote:
>
>
> I need help on how to open a webpage and save the HTML to a given file
> path, given a URL.
>
How do I create a python function that opens a CSV file and determines how many
columns
of data are in the file? The CSV files have been randomly generated from
https://www.mockaroo.com/
def csv_column_count(openfile):
___
Tutor maillist - Tutor@pyth
I need help on how to open a webpage and save the HTML to a given file path,
given a URL.
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
https://mail.python.org/mailman/listinfo/tutor
I need help on the problem below,
Given a URL, open the webpage and save the CSV to a given file path.
def save_url_to_csv_file(url, savefile):
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
https://mail.python.
Hi Stephanie,
I'm wondering which courses you were introduced to Python and which book you
are using. I do understand how it might be difficult to understand this
concept, especially for someone who is a complete novice to algorithm
analysis where Big O shows up.
I'll answer you inline.
-Origi
Hi,
My answers are below.
-Original Message-
From: Tutor [mailto:tutor-bounces+joseph.lee22590=gmail@python.org] On
Behalf Of Rance Hall
Sent: Sunday, January 4, 2015 9:20 PM
To: tutor
Subject: [Tutor] threading in python 2.7 - 2nd version
Thanks to the advice from Joseph and Alan, I
Hi,
Answers are below.
-Original Message-
From: Tutor [mailto:tutor-bounces+joseph.lee22590=gmail@python.org] On
Behalf Of Rance Hall
Sent: Friday, January 2, 2015 12:17 PM
To: tutor
Subject: [Tutor] threading in python2.7
Each of the lights and sound functions are placed in a "while
Oops, sent it to the original poster only.
-Original Message-
From: Joseph Lee [mailto:joseph.lee22...@gmail.com]
Sent: Friday, December 19, 2014 1:43 AM
To: 'Brandon Dorsey'
Subject: RE: [Tutor] Learning to program, not code.
Hi Brandon,
Answers are below.
-Origin
Hi Terry (if that's your name),
Start slow - don't think ahead too much. It is a good thing that
you know the end product, but sometimes when building a real-life
system, you might want to work with one aspect of the program at
a time (input, calculations, print, etc.) to make sure it works
a
Hi,
My thoughts are in the message:
- Original Message -
From: Terry--gmail Subject: [Tutor] Building Starships -- object of type 'int' has
no len()
Python 3.3
This has something to do with the nature of FOR statements and IF
statements, and I am sure it must be a simple mistake...b
Hi Keith,
It depends on what you want to do with Python in the end (by the
way, if statement is not a function).
Here are some of my suggestions (based on current topics and
things to come later):
1. Write a loop which prints even numbers from 1 to 100.
2. Write a program which determines
Hi Keith,
As a follow-up: I'm sure others might have mentioned this, but I
also recommend doing exercises presented in the book or reference
you're using to learn Python.
Cheers,
Joseph
- Original Message -
From: keith papa Hi, am a newbie to python and I wondering if you guys can give
Hi,
Answers are below.
- Original Message -
From: keith papa Am a newbie to programming and I started learning python days
ago. I have this idea I want to execute, am a big sport and
fantasy fan and I wanted to create something that will make it
things a little easy for me. My idea
Hi,
Answers are below.
From: Tutor [mailto:tutor-bounces+joseph.lee22590=gmail@python.org] On
Behalf Of idiallo.s...@gmail.com
Sent: Sunday, July 13, 2014 9:16 AM
To: Python Tutor Mailing List
Subject: [Tutor] Python 2 Vs python 3
I am in the process to dive into python and start lear
Hi Steve,
In your conditionals:
…
while message != 'q' or 'Q'/message != “q” or message != “Q”:
…
Python will only match the first variable. A better approach (which might be a
good solution) would be capturing the exit commands in a list like this:
JL’s code:
while message not in [“q”, “Q”]
Hi Deb and others,
Most are for people coming from different languages like C/C++, Java and so
on (I myself am coming from C++ world, and can speak both C++ and Python).
Unless if you're working on specific things, don't worry about some of the
concepts until later (e.g. if you're working on variab
Hi Deb and others,
Answers are below.
-Original Message-
From: Deb Wyatt [mailto:codemon...@inbox.com]
Sent: Friday, July 11, 2014 9:51 PM
To: Joseph Lee; tutor@python.org
Subject: RE: [Tutor] Anti-Patterns in Python Programming
Thank you for answering. I used to be a Clipper/dBase
Hi all
I just started to learn python language.
I'm trying to figure out the reason of error but i couldn't find it.
first imports short.txt(is attached to this mail)
and read in dictionary named gpdic1
Traceback (most recent call last):
File "/home/ercsb/test.py", line 11, in
hgene = line
Hi, I have read the book 'a byte of python' and now I want to read another
book. But I just get confused about which one to read next.
There is a book list below：
1, pro python
2, python algorithms
3, python cookbook
4, the python standard library by examples
which one is suitable for me??
Or I ne
> is there another way to print a PDF form python?
>
> My problem is a PDF which is printed well by evince, but not with lp,
> even not out of python using
>
> os.system("lp some_options file.pdf")
>
> Later on I have to build the PDF in a python program (using reportlab)
> and then print it, eve
> I am very interested to hear your opinion on which version of Python
> to use in conjunction with Django. Currently, I am taking a class at
> Udemy and they recommend using Python 2.7 with Django 1.6. because
> both versions work well with each other.
>
> Over the last few months I got pretty muc
Hello,
I am using python to calculate distances across the cell.
I used this command: python calculate_distances.py
This was the response:
Traceback (most recent call last):
file "calculate_distances.py" line 4, in
import celltool.simple_interface as si
ImportError: No module named celltool.simp
> grep ^TTCTGTGAGTGATTTCCTGCAAGACAGGAATGTCAGT$> with no results
How about:
grep TTCTGTGAGTGATTTCCTGCAAGACAGGAATGTCAGT outfile
Just in case there is some non-printing character in there...
Beyond that ... my guess would be that you are either not readingthe file you
think you are, or not writi
> I learned python so that if I were to put in 0.9, it'd decrease red by 10%.>
> The way this function needs to be written, -0.1 decreases red by 10%
It sounds like you have something like ...
def f1(color, redchange=0, bluechange=0, greenchange=0): # some code here to
make the changes ret
> How do I create a small IRC program which can send and receive private
> messages from users?
I created a multiplayer game that can create a standalone
server like a MUD, or communicate over IRC, or both (I think)
acting as a gateway between the two.
It uses Twisted, which some find arcane, b
Apples and 7 oranges
From: Alan Gauld
To: tutor@python.org
Sent: Wednesday, 18 May 2011, 8:07
Subject: Re: [Tutor] Sequencing
"Cindy Lee" wrote
> ...asked to make a function that receives text as an argument
> and returns the same text, but with 1 added to
Thanks for the advice. I seem to keep getting the same errror:
>> help(str.__add__)
Help on wrapper_descriptor:
__add__(...)
x.__add__(y) <==> x+y
From: Dave Angel
To: Cindy Lee
Cc: "tutor@python.org"
Sent: Wednesday, 18 May
Hi Pyton Tutors thanks for adding me,
I am new to Python and missed one of my classes and am not sure of my homework.
We are currently on sequencing and are being asked to make a function that
receives text as an argument and returns the same text, but with 1 added to
each number. So far I have
>>> I have data about zip codes, street and city names (and perhaps later also
>>> of
>>> street numbers). I made a dictionary of the form {zipcode: (street, city)}
>>
>> One dictionary with all of the data?
>>
>> That does not seem like it will work. What happens when
>> 2 addresses have the sam
> I have data about zip codes, street and city names (and perhaps later also of
> street numbers). I made a dictionary of the form {zipcode: (street, city)}
One dictionary with all of the data?
That does not seem like it will work. What happens when
2 addresses have the same zip code?
> Are th
> I know that I can look up the value for a particular key in a
> dictionary, but can I look up the key associated with a particular
> value?
I am using bidict in one of my projects:
http://pypi.python.org/pypi/bidict/0.1.1
It's probably a bit more complex than what I
need, but the parts I am u
> Are there any Python modules to script Blender? For example, placing
> predefined objects into a new Blender project to create a 3D model.
If you are using 2.5, I saw this posted on blendernation.com
just today:
http://blenderartists.org/forum/showthread.php?t=193908
> hey this is a crazy question but i want to know it..
> suppose i have this code
>
> a=raw_input("enter the string :")
> print a
>
> then i type python prog.py
>
> output:
> enter the string:hello
> hello
>
>
> now i want to ask is there's any way that python remembers the input i gave
> it t
> Just out of curiosity does anyone know why you get a deprecation warning if
> you pass a float to range but if you use round, which returns a float, there
> is no warning?
It has nothing to do with the round.
It's just that the warning is only shown once:
$ python
Python 2.6.5 (r265:79063, Ap
I usually just use NetBeans or the Python IDLE.
I prefer to use NetBeans because it's easier to change and modify code and
test. And also because I like to use Jython.
Anything wrong with my setup?
On Tue, Jan 19, 2010 at 8:17 AM, Alan Gauld wrote:
>
> wrote
>
>
> order to create an efficient
Hi tutors,
So I finally made my program. When I run it with python, it works perfectly!
But when I convert it to an executable using py2exe (correctly), I get an error:
Traceback (most recent call last):
File "oentry.py", line 52, in
File "Tkinter.pyc", line 3270, in __init__
Hello!
Before I tell you about my problems, I ask for your consideration as I am a
newbie at python...
I was having problems as I tried to open another program within a program (both
programs are Tkinter UIs)
As for the reference, here is my code:
#program: realprogram.py
from Tkinter impor
or when you hit the letter "b"
Traceback (most recent call last):
File "C:/Users/Lee/Desktop/pyGame01/GO/GO_1_2_3.py", line 46, in
for stone in len(black0):
TypeError: 'int' object is not iterable
Which I'm not really sure what that means or how to reme
> From: [EMAIL PROTECTED]> Subject: Tutor Digest, Vol 53, Issue 89> To:
> tutor@python.org> Date: Fri, 25 Jul 2008 12:01:02 +0200> > Send Tutor mailing
> list submissions to> tutor@python.org> > To subscribe or unsubscribe via the
> World Wide Web, visit> http://mail.python.org/mailman/listinfo
Hello,
I am trying to urlencode a string. In python the only thing I can see
is the urllib.urlencode(). But this takes a dictionary, and returns
"key=value", which is not what I want. I only want to url-encode a
string. Does any one know how to do this in python
T
>http://www.velocityreviews.com/forums/t343990-xmlrpc-send-file.html
>
>Using this example I get error's about 'expected binary .read(), but got
>instance instead.
I assume you are using this ...
>d = xmlrpclib.Binary(open("C:\\somefile.exe").read())
Are you using windows?
I think you would n
In Python, how to do that ?
sys.platform only gives 'win32', no info about 32-bit or 64 bit ?
Thanks.
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
> >>> print "%14.3g\n%14.3e\n%14.3f" % (bignum,bignum,bignum)> 1.23e+009
>1.235e+009> 1234567898.235>> But in practice, we do not know how big is the data in advance when> doing scientific computation in a compiled program.That is irrelevant, the format you display the data in has
no b
What is the exact meaning of %g in Python ?
From Python ducumentation:
%g: Same as "e" if exponent is greater than -4 or less than precision, "f" otherwise.
But if %.mg is used, I don't see the rules. See the following example:
So here it follows the above rule:
>>> print "%.16g" % 0.00
>I subscribed to the pygame-users mailing list through [EMAIL PROTECTED],
>but I don't know where to send the mail too so that everybody can see it.
>
>Any suggestion on how to use that mailing list?
>
http://www.google.com/search?q=pygame+mailing+list
2nd link ...
"""
Pygame maintains an active
Sorry about misposting this here. I always mix up the
tutor@ and edu-sig@ lists. I am just going to follow
up two things that seem tutor related.
If this seems interesting, you may want to join the
edu-sig list for more...
>>More frightening to me than the ubiquitous use of MS Office is the
>>o
>My son is learning something about using a spreadsheet - extremely
>useful and I support it 100%. That he thinks what he is learning is
>Excel is absolutely unforgivable, in terms of my understanding of
>ethical norms that once prevailed in an institute of higher education.
>
I guess it depends
> I've edited the aliens.py example to make my character just move
>back and forth. However I can't make him jump!
It is not really clear to me from your code where you expect the
character to jump. I do not see the word "jump" anywhere. I do
see the word "bounce" and one reference to the to
> > >Is there a command like more(1) or less(1) in python to display
> > >the output of a command (e.g. dir()) one page at a time?
> >
> >
> > How are you using dir() ?
> >
> > Is it in the "DOS Window" ?
> > One option would be to just get a better console.
>
>I am using Python 2.4 on RedHat Linux
>Is there a command like more(1) or less(1) in python to display
>the output of a command (e.g. dir()) one page at a time?
How are you using dir() ?
Is it in the "DOS Window" ?
One option would be to just get a better console.
You also might want to look at something like ipython.
Using that,
>I've been looking at lots of sites and checked out the docs, but can't
>find the info I am looking for to be able to detect audio input from
>my sound card.
You do not say if you need to do this in a cross-platform way.
I thought maybe SDL (which is wrapped by pygame) might help,
but this is cl
lone or in combination with a group
(e.g. + gmane.comp.python.tutor), or alone (server) with the group in
the subscription window to work.
Are you using Gmane successfully?
Thanks
Lee C
On Jun 9, 2005, at 4:12 PM, Karl Pflästerer wrote:
> On 9 Jun 2005, [EMAIL PROTECTED] wrote:
>
>
&g
is list using a newsreader and I would
appreciate the list name used.
Thanks,
Lee C
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
how can i get my email address removed, I'm receiving way too many
emails
You have a few options. You may want to see if just turning the Tutor
mailing list setting to "Digest Mode" might help. You can do this
through:
http://mail.python.org/mailman/options/[EMAIL PROTECTED]
Personally, I fi
ram ;') Anyway, starting with
assembler in the 60s, and doing my last substantial technical work in
the 80s with C and Pascal, I have a bit of catching up to do :~)
Thank you all for pointing me in the right direction,
Lee C
___
Tutor maillist
le code structure to re-map is
shaping up otherwise.
Thanks,
Lee C
On Jun 8, 2005, at 1:10 AM, Javier Ruere wrote:
> Lee Cullens wrote:
>
>
>> I was thinking of extending the learning exercise by re-factoring it
>> as an OO approach, since it would contain a minimum altered met
lot on OOP, but seem to have a problem with the practical
use of such in this utility. I'm undoubtedly creating a mountain of
an ant hill in my mind, so any thoughts would be appreciated.
Thanks,
Lee C
___
Tutor maillist - Tutor@
s in posting this exercise is to first understand alternatives before I decide what I like best :~) Your points, together with Javier's points on presentation and thoroughness, and Liam's point on making the logic more obvious are appreciated. Thank you all for taking the time to offer y
Such would serve to pull the test and the reason for it together -
more obvious.
Which is a good point in writing code that others may read.
Thanks Liam
On Jun 5, 2005, at 9:29 AM, Liam Clarke wrote:
>
>
> > There is no need for the if(dlst); if the list is empty the
> iteration will do n
>At present, the only thing I can think of is to redirect the
>output of 'ifconfig' into a temporary file, then read it back in and use
>Python and regular expressions to try and extract the IP info from that.
That is basically how I do it. See here:
http://mail.python.org/pipermail/python-list/2
vline so that csvline would end up '"",'*x plus '"c","d",'
>>> pl = ['a', 'b', 'c']
>>> csvl = '"",'
>>> csvl += '"'.join(pl[0:2]) + '",'
>>&g
On Jun 4, 2005, at 9:32 PM, Javier Ruere wrote:
> Lee Cullens wrote:
>
>> The initial os.walk() approach I tried is simple in concept:
>>
>> pgo = os.walk(base_directory)
>> for xnode in pgo:
>>
>>
>> but I ended up with much more process
Thanks for the critique Kent
On Jun 4, 2005, at 6:54 PM, Kent Johnson wrote:
> Lee Cullens wrote:
>
>
>> Pythonese/Efficiency/Generalese critique please
>>
>> I'm new to Python and as an exercise created a little utility module.
>> I'm learnin
Sorry about the double post. I sent with the wrong from address so I
resent with the correct address and before I could cancel the first
the moderator had let it through :~)
Lee C
___
Tutor maillist - Tutor@python.org
http://mail.python.org
ordering in one pass.
Lee C
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
ordering in one pass.
Lee C
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
you see fit to offer.Thank you,Lee CDual 2.5 Power Macintosh G5 (OS 10.4.1) ___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
>> > I've been using MySQL up this day, but would like to convert my
>> > program to use Postgresql.
>>
>>I'm curious. Why?
>>Is there some advantage to Postgres over MySql?
>
>Postgres behaves a lot like Python in that it'll die early rather than try
>to guess at what the user means. Postgres han
>data = {}
>data['ids_to_process'] = ['1','2','3','5','7','11']
>
>query = '''
>UPDATE my_table
> SET state = 'processed'
> WHERE id IN ARRAY%(ids_to_process)s
>'''
>db.execute(query, data)
>
Sorry. It should look like ...
query = '''
UPDATE my_table
SET state = 'processed
>data = {}
>data['start_date'] = '2005-6-2'
>data['last_name'] = 'Johnson'
>
>query = '''
>SELECT *
> FROM my_table
> WHERE date >= '%(start_date)s'
> AND last_name = '%(last_name)s'
>''' % data
>results = my_database.Execute(query)
First up. This is a "bad idea".
It may be ok
I find the following invaluable - maybe you will also.
http://rgruet.free.fr/PQR24/PQR2.4.html
Lee C
On May 27, 2005, at 11:25 PM, Servando Garcia wrote:
> Hello
> Is there a increment operator in python similar to c++
> like so &quo
>using autocomplete feature within Eclipse
Are you using pydev?
http://pydev.sourceforge.net/
Their website says:
"""
New Release: 0.9.3!!
Wohooo!! Code completion Rules! Check it out!
"""
So apparently this is something they are actively working on.
You may have an old version, or you may have
>Content-Type: text/html; format=flowed
>
>
[...]
What a mess.
You should to post to the list in plain text.
Someone might take the time to weed through that for your
question, but you will get a lot more help and a lot sooner
if you just configure your mailer to send plain text.
__
stem, or you could use pygame.
>
>Ok drat. I was hoping that it would play the files.
>
>
>
>>--
>>Lee Harr wrote:
>>
>>If you are on windows try the winsound module.
>
>And if I'm on Linux or programing for Mac?
>
>>>What I need to do is validate a date field (better if it's already done)
>>>and
>>>I want to know if anyone knows about a code to do that (a made code,
>>>don't
>>>mean you to do my work). I was hoping to find a calendar combo box as in
>>>Visual Basic DropDown Calendar
>>>
>>>
>>For which GUI s
>What I need to do is validate a date field (better if it's already done)
>and
>I want to know if anyone knows about a code to do that (a made code, don't
>mean you to do my work). I was hoping to find a calendar combo box as in
>Visual Basic DropDown Calendar
For which GUI system?
py-qt has Da
>I can't get:
>
>import wave as w
>
>... to play a .wav music file. I tried w.play() but got an error that
>module has no attribute 'play'.
>What do I use to get it to play?
Strangely... I do not believe the wave module is meant to actually
_play_ a wav file. It looks to me like it is only inte
ative to a common root directly.
We'll let the experts take it from there.
Lee C
On May 22, 2005, at 7:54 PM, Joseph Quigley wrote:
> I've seen many (python) "plugins" (some located in site-packages
> [windows
> here]) with the name __init__.py.
> What'
Mike,
You may not be looking for a commercial IDE, but I am very happy with
WingIDE and using it with Tiger.
Lee C
On May 18, 2005, at 6:54 PM, Mike Hall wrote:
> I should of specified that I'm looking for an IDE with full
> debugging. Basically something like Xcode, but with Pyt
>>Inconsistent indentation styles are very
>>annoying in
>>other languages, but a fatal problem in Python.
>
>But there is no way to enforce standard settings. When new versions are
>installed or someone just makes a mistake the settings might change and
>you won't know until it's too late...possi
n such anymore :~)
Thank you,
Lee C
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
>The idea is to print out a multiplication table on the command line
>with numbers lining up in the ones column. I want to eventually
>emulate programs like top with their spacing. But this code is mostly
>for my amusement. How would you make this work?
>
Try print string formatting using %
>>>p
>import os
os.system("fec=cam`date +%Y%m%d%H%M%S`.jpg")
>0
os.system("echo $fec")
>0
os.system("mv hola.txt grabacion/$fec")
>0
Each system() call gets a fresh shell, and a fresh env ...
>>>import os
>>>os.environ['foo'] = 'bar'
>>>os.system('echo $foo')
bar
0
>>>os.system('foo=zzz')
>Does anyone know of a Web Calendar written in Python?
I believe that SchoolBell is using Zope 3 ...
http://www.schooltool.org/schoolbell
_
Express yourself instantly with MSN Messenger! Download today it's FREE!
http://messenger.m
I assume you mean PythonIDE for Python 2.3 (I usually use 2.4 and
WingIDE). Here it is (indents screwed up with var font):
HTH,
Lee C
Python 2.3 (#1, Sep 13 2003, 00:49:11)
[GCC 3.3 20030304 (Apple Computer, Inc. build 1495)]
Type "copyright", "credits" or "lice
> yes = 0
>>> for num in x:
... if 5 not in num:
... if not yes:
... print 'yes'
... yes = 1
...
yes
On Apr 19, 2005, at 12:31 AM, Lee Cullens wrote:
As you probably have already found out the expression
>>> print [ e for e in x if 5 in e]
will pro
Thank you Brian for making the point that I did such a poor job of
conveying. My post did indeed fail to clearly and concisely answer the
question.
Lee C
On Apr 18, 2005, at 11:34 PM, Brian van den Broek wrote:
Lee Cullens said unto the world upon 2005-04-18 21:07:
That just gives you a spacer
inting yes.
If you change your test to check for 5 in a sub list and, print yes and
break at that point you will get the results you are looking for.
>>> for num in x:
... if 5 in num:
...print "yes"
...break
...
yes
>>>
Lee C
On Apr 18, 2005, at 1
That just gives you a spacer line after your output. To see such as a
separator change it to print '*'*10
On Apr 18, 2005, at 8:55 PM, Hoffmann wrote:
Hi All:
I am a newbie, and I am enjoying to study Python a
lot. I have a question about an example I got from one
of my books.
The program is:
d
of a more involved algorithm.
Functions are also useful (even necessary) in various approaches to
problem solving. If you need an example one might be the recursive
matrix solution approach I posted a link to in another post to this
list.
Lee C
On Apr 17, 2005, at 12:29 PM, Joseph Quigley
Pickling simply converts an object to a string (unpickling does the
opposite,
convert a string to an object). The dump() function writes the generated
string
directly to a file, but you can use the dumps() function to get the
generated
string as such and do something else with it (e.g. put it in
We are developing a CBT based "Free Software" for our
social activities. We are using PyGTK alongwith Glade.
We want to print a document through Printer and also
we want to provide "Sound" support in our software.
Has somebody worked on PyGTK or Python? We are not
getting the PyGTK API's for sound
packages to do the grunt work, but
it helps to understand the problem.
Lee C
On Apr 14, 2005, at 21:06, [EMAIL PROTECTED] wrote:
I've seen a couple of nice tutorials on recursion, and a lot of awful
ones. The latter always trot out the fibonacci and factorial examples
for some reason
Thank you, Liam and Steve, for the informative feedback.
Lee C
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
,
On Apr 13, 2005, at 1:04 PM, Lee Cullens wrote:
John
The type of problem you mention and the extent of positioning you go
to could result in an incomplete solution. In very general terms one
would need to place the first Queen then find an appropriate position
for the second, and each of the
ore academic (an
younger) members of this list can point you in such a direction.
Lee C
On Apr 13, 2005, at 12:15 PM, [EMAIL PROTECTED] wrote:
I read through Magnus Hetland's book and noticed the Eight Queens
problem, which I had solved some time ago using Visual Basic.
This time, I wanted to u
for the slicing see: http://docs.python.org/lib/typesseq.html
for a longhand loop approach see:
http://docs.python.org/tut/node6.html#SECTION00620
On Apr 13, 2005, at 12:46 AM, Danny Yoo wrote:
-- Forwarded message --
Date: Tue, 12 Apr 2005 22:37:44 -0500
From: J
imedia presentations)
potentially for cross platform (and pyObjC for Mac only) -
opinions/pointers anyone or maybe *another* better course?
Thanks,
Lee C
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
I have apparent interference between doctests embedded in the
docstrings of different methods, and this interference also appears to
be influenced by seemingly irrelevant things such as whether the
module has a (non-doctest-containing) docstring or not.
I, and what hair I've not yet torn out, woul
1 - 100 of 115 matches
Mail list logo
