On 10/17/2012 11:41 PM, boB Stepp wrote:
> >From Programming in Python 3, 2nd edition (p. 22-23):
>
a = ["Retention", 3, None]
b = ["Retention", 3, None]
a is b
> False
b = a
a is b
> True
>
> My current understanding is as follows: On the first two lines, two
> separate ob
>From Programming in Python 3, 2nd edition (p. 22-23):
>>> a = ["Retention", 3, None]
>>> b = ["Retention", 3, None]
>>> a is b
False
>>> b = a
>>> a is b
True
My current understanding is as follows: On the first two lines, two
separate objects are defined, stored in two separate blocks of memory
Mike,
A brief comment before I start:
your post would be a lot more readable and understandable if you were to
break it up into smaller paragraphs, each of which explains one point.
Otherwise it is a great wall of text which is fairly intimidating.
On 18/10/12 06:51, Mike wrote:
My program i
On 17/10/12 11:29, Cheng wrote:
I couldn't see any comment or question in there.
When posting could you please follow the instructions:
When replying, please edit your Subject line so it is more specific
than "Re: Contents of Tutor digest..."
And also delete any irrelevant content. It makes
On 10/8/2012 11:55 AM, Tharuni Dheeraj wrote:
please send me the program for the following que:
Write a program that asks the user for a dollar amount.It then reports
the corresponding number of euros by using the current exchange rate.
As the list name (Tutor) suggests we are here to help yo
Thanks for the help! Not sure why I assumed that csv.reader was returning
row as a tuple instead of a list... that makes that part easier ;)
As for the 'INSTEAD OF' trigger on a VIEW... that *does* look pretty
handy. I was trying to remember why I hadn't heard of that before, or why
I hadn't loo
On Wed, Oct 17, 2012 at 8:02 AM, Dave Angel wrote:
>
> Is this a homework assignment where you might be expected to build a
> complex loop, or is it a problem you're solving where you would be
> allowed to use itertools.groupby ?
May as well post a groupby solution. I doubt it would be accepted f
On 10/05/2012 11:55 PM, Benjamin Lee wrote:
> Hello,
> I am using python to calculate distances across the cell.
> I used this command: python calculate_distances.py
> This was the response:
> Traceback (most recent call last):
> file "calculate_distances.py" line 4, in
> import celltool.simple_
On 10/13/2012 07:02 AM, syed zaidi wrote:
> Hi,I am trying to develop a python code that takes a character string as
> input and finds for the occurrence of letters that are occurring thrice or
> more consecutively.For E.g.
> a = 'ataattaaacagagtgagcagt'In the output I want a list of tho
On 17/10/12 12:30, Dwight Hutto wrote:
My inexperienced advice would be to begin with the storage areas
available. I would begin by eliminating certain things such as:
x = {'one_entry' : 1}
into
x = {'one_entry':1}
Those two entries are exactly the same. The presence of absence of
spaces,
On 08/10/2012 16:55, Tharuni Dheeraj wrote:
please send me the program for the following que:
Write a program that asks the user for a dollar amount.It then reports the
corresponding number of euros by using the current exchange rate.
--
Regards,
Tharuni Dheeraj
__
On 17/10/12 19:23, Dae James wrote:
I found that VPython is not in PyPI(python packet index from
www.python.org). Why ?
You'd have to ask the author of VPython. Being on PyPI is not
compulsory, nobody is going to force him to use PyPI if he
doesn't want to.
--
Steven
On Thu, Oct 11, 2012 at 3:29 PM, Stephen Hooker wrote:
>
> I try to store 1 result it works fine. If I try to store more than 1 result
> I get one or the other, never both. The code is below (not the whole
> program)
>
> for i in range(2):
> pos = random.randrange(0,len(rolling_stock_OS))
> pick =
tutor-requ...@python.org编写：
>Send Tutor mailing list submissions to
> tutor@python.org
>
>To subscribe or unsubscribe via the World Wide Web, visit
> http://mail.python.org/mailman/listinfo/tutor
>or, via email, send a message with subject or body 'help' to
> tutor-requ...@pyth
Hello, I'm using Python 2.6 to generate switch lists for a model railroad.
I had some help before, possibly from this site but have encountered
another problem. I realise the code could be better written, but learning
Python is a work in progress. The program works much as expected except
when I t
Hi,I am trying to develop a python code that takes a character string as input
and finds for the occurrence of letters that are occurring thrice or more
consecutively.For E.g.
a = 'ataattaaacagagtgagcagt'In the output I want a list of those
characters that are occuring thrice or more.
On Oct 7, 2012, at 8:06 PM, Dave Angel wrote:
> On 10/07/2012 08:00 PM, Jan Karel Schreuder wrote:
>>
>>
>> On Oct 7, 2012, at 7:24 PM, Dave Angel wrote:
>>
>>
>
>>>
>>> It still makes no sense to me. There are at least two equally silly
>>> ways to define the results of a nega
please send me the program for the following que:
Write a program that asks the user for a dollar amount.It then reports the
corresponding number of euros by using the current exchange rate.
--
Regards,
Tharuni Dheeraj
___
Tutor maillist - Tutor@python
Hello,
I am using python to calculate distances across the cell.
I used this command: python calculate_distances.py
This was the response:
Traceback (most recent call last):
file "calculate_distances.py" line 4, in
import celltool.simple_interface as si
ImportError: No module named celltool.simp
On Tue, Oct 16, 2012 at 12:57 PM, Abhishek Pratap
wrote:
> Hi Guys
>
> For my problem I need to store 400-800 million 20 characters keys in a
> dictionary and do counting. This data structure takes about 60-100 Gb
> of RAM.
> I am wondering if there are slick ways to map the dictionary to a file
>
__
>>> I'm not a professional programmer, so I might be way off base here.
You mean you haven't dealt with this subject yet...
But what I like about Pythons modulo solution is that I can use it to
right and left shift in lists or tuples, and I will link
If your app has a standard usage of phrases, you can place a file in
that translates a tag into a particular language phrase.
if submit_tag_selection == 'english':
submit = 'Submit'
if submit_tag_selection == 'english':
submit = 'Soumettre'
Of course this could be done without the if
On Tue, Oct 16, 2012 at 11:59 PM, Monte Milanuk wrote:
>
> address = list(row)
> address.append(person)
> row = tuple(address)
The rows from the csv.reader are already lists. Also, the parameter
list in the 2nd argument only needs to be a sequence (e.g. tuple,
list, string
On 17/10/2012 03:22, Alexander wrote:
On Tue, Oct 16, 2012 at 20:43 EST, Mark Lawrence
wrote:
For the record Access is not a database, or so some geezer called Alex
Martelli reckons http://code.activestate.com/lists/python-list/48130/, so
please don't shoot the messenger:)
Cheers.
Mark Lawrence
On 17/10/2012 09:23, Dae James wrote:
I found that VPython is not in PyPI(python packet index from www.python.org).
Why ?
Dae James
The author(s) have chosen not to place it there.
--
Cheers.
Mark Lawrence.
___
Tutor maillist - Tutor@python.or
I found that VPython is not in PyPI(python packet index from www.python.org).
Why ?
Dae James___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
26 matches
Mail list logo
