I don't know about TRICAST, but package actuar (on CRAN) provides some
more specifically actuarial functionality to R. You may want to have a
look. See also http://www.actuar-project.org,
Le lun. 14 juil. à 17:47, Kenneth Roy Cabrera Torres a écrit :
Hi R users:
I will like to know if some
Tariq,
See inline for my reply.
Le mar. 15 juil. à 21:48, Tariq Perwez a écrit :
Hi Everyone,
I have a few fairly basic questions about upgrading and installing R
packages. First off, I am using Ubuntu Hardy Heron and have R 2.7.1
installed and working perfectly. I usually access R via Emacs
Dear list,
I am analysing a set of quantitative proteomics data from 16 patients
which has a large numbers of missing data, thus some proteins are only
detected once, upto a maximum of 16.
I want to test each protein for normality by the Shapiro Wilk test
(function shapiro.test in package st
Dear R-Users,
I wish to simulate a binary outcome data set with
predictors (in the example below, age, sex and systolic BP). Is there a
way I can set the frequency of the outcome (y) to be say 5% (versus the
0.1% when using the seed below)?
# Example R-code based on Frank Harrell's De
On Mon, 14 Jul 2008, Erik Iverson wrote:
gregexpr("\\(", frg)
Better
gregexpr("(", frg, fixed=TRUE)
(there is no regular expression here), but in this case
which(unlist(strsplit(frg, "")) == "(")
is more efficient (especially if you want to do further manipulations on
the individual c
Hi!
My problem: i can't use the automatic package installation via the GUI since
I am behind a Proxy.
I tried installing Authoxy which solved the Problem for some other programs
but not for R.
I'm really new to R and Mac and therefore a bit confused... I can't find any
internet connection setting
Hi group!
GNU enscript is a free (as in freedom) text file decorator, which
among other features can highlight source code files. The language
syntax descriptions are provided via special "states" files. The
standard distribution contains states files for the most popular
languages (C, C++, Pascal
Dear R Users,
I am trying to suppress the information printed by the ecdf function
during an assignment. Various alternatives have failed me so far:
> a=summary(ecdf(rnorm(100)))["1st Qu."]
Empirical CDF:100 unique values with summary
> invisible(a=summary(ecdf(rnorm(100)))["1st Qu."])
Empir
If you do:
getAnywhere('summary.ecdf')
you will see the 'cat' statement that is doing
the printing that is annoying you.
It seems to me that a better definition of the
function would have an argument called something
like 'verbose' that controlled if the 'cat' statement
was executed.
I'm not s
On Tue, 15 Jul 2008, LostInTimeAndSpace wrote:
Hi!
My problem: i can't use the automatic package installation via the GUI since
I am behind a Proxy.
I tried installing Authoxy which solved the Problem for some other programs
but not for R.
I'm really new to R and Mac and therefore a bit confus
Hi Dylan,
>> I am curious about how to interpret the table produced by
>> anova(ols(...)), from the Design package.
Frank will perhaps come in with more detail, but if he doesn't then you can
get an understanding of what's being tested by doing the following on the
saved object from your OLS ca
An alternative to enscript is highlight,
http://www.andre-simon.de/doku/highlight/en/highlight.html, which does
come with R highlighting built in.
Hadley
On Tue, Jul 15, 2008 at 2:57 PM, [EMAIL PROTECTED] <[EMAIL PROTECTED]> wrote:
> Hi group!
>
> GNU enscript is a free (as in freedom) text file
On Tue, 15 Jul 2008, Patrick Burns wrote:
If you do:
getAnywhere('summary.ecdf')
you will see the 'cat' statement that is doing
the printing that is annoying you.
It seems to me that a better definition of the
function would have an argument called something
like 'verbose' that controlled if
Hello
Since the summary.ecdf function first do a "cat", and then calls
summary(knots(object),...) , I guess you will obtain the same result
without the printing, by just use the latter part of the summary.ecdf
function like this:
a <- summary(knots(ecdf(rnorm(100["1st Qu."]
Hope this he
Colleagues,
I have encountered the following problem using R2.7.0 in Windows
(Vista).
I want to delete a series of functions before I close an R session. I
execute the following commands from a script:
FunctionsToDelete <- c("function1", "function2", "function3")
for (EachFunction in
Seems to work fine for me. Short version is at the end:
> for (i in 4:368){
+ assign(paste("V", i, sep=''), 1:10)
+ }
> Temp <- data.frame(V4, V5, V6, V7, V8, V9, V10, V11, V12, V13, V14, V15,
+ V16, V17, V18, V19, V20, V21, V22, V23, V24, V25, V26, V27, V28, V29, V30,
+ V31, V32, V33, V34, V
Example:
myfunction <- function(mydata, myvariables, prefix="norm_"){
newnames <- paste(prefix, myvariables, sep="")
mydata[newnames] <- scale(mydata[myvariables])
mydata
}
mydata <- data.frame(a=1:2, b=3:2)
myfunction(mydata, c("a", "b"))
Moira Burke wrote:
Hi. I'm a
Many thanks all for the response, this worked.
Hi Martin, the "verbose" recommendation below would be very useful if
this could be considered for a future release of stats/ecdf.
Regards,
Tolga
Ivar Herfindal <[EMAIL PROTECTED]>
15/07/2008 10:38
Please respond to
[EMAIL PROTECTED]
To
Patri
thanks
Simon Blomberg-4 wrote:
>
> Jim Lindsey's repeated package has the function gnlmm which will fit
> beta regressions with a random intercept and one level of nesting. I
> don't know of any other options.
>
> Cheers,
>
> Simon.
>
> Not sure On Mon, 2008-07-14 at 19:16 -0700, Daniel Mal
I am not sure what your data looks like. Do 'str(sc)' to show the
structure. I created a set and this is what I got:
> x <- list(sc,sc,sc,sc)
> x
[[1]]
DayOfYear Quantity Fraction Category SubCategory
1 1 82 3.903927e-05 (Unknown) (Unknown)
2 2 78 3.713492e-0
Dear helpers,
I've got a main script, which calls 4 times a function on 4 different
datasets respectively. This function runs "nls" and is located in
another R script which is sourced into my main script.
What I would like to have is this:
If, e.g. in the 3rd call of the function, nls fails, bec
Hi,
I am trying to plot a distribution over a histogram with the polygon()
function. However I have to use this function after hist() and that
makes the polygon cover the histogram. I would prefer having the
histogram at the top layer and the polygon as the background. Is that
possible?
A workaro
yes R has everything that TRICAST offers.. and much more
Kenneth Cabrera-2 wrote:
>
> Hi R users:
>
> I will like to know if somebody works on insurance statistics
> (actuarial problems) and had use TRICAST, and can tell me
> if with all the R tools it can be build a solution
> like TRICAST or
Hi Thomas,
without really knowing how your plot looks like: You could try to redraw the
first plot in the same device, i.e.:
#graph it
hist(weights$Weight, freq=TRUE, breaks=breakpoints, main=wfiles[i])
#lines(dens)
polygon(dens$x, dens$y, border=NA, col=rgb(1,0,1,0.5))
#direct into open device
p
Hi All,
I have to draw a best fit line in a helix that will tell the axis of the
helix and a
curve that will tell the curvature of the helix. I suppose I have to do
linear and
non linear regression in 3D space for this ?
I have coordinates in following structure
'data.frame': 24 obs. of 3
Hi everyone,
I want to score a set of data (-ve to +ve) using a 0-10 scale. I have the
data in an R matrix, so I need to add another column, containing the scores
and resave.
I would be grateful for suggestions on how best to do this.
Thanks,
rcoder
--
View this message in context:
http://ww
Thank you!
Works perfectly.
On Tue, Jul 15, 2008 at 1:31 PM, René Capell <[EMAIL PROTECTED]> wrote:
> Hi Thomas,
> without really knowing how your plot looks like: You could try to redraw the
> first plot in the same device, i.e.:
>
> #graph it
> hist(weights$Weight, freq=TRUE, breaks=breakpoint
Sure.
I have the following command:
sc <- split(x, list(x$Category, x$SubCategory), drop=TRUE)
where x is
x <- read.csv("Sales2007.dat", header=TRUE)
and the first few rows are:
DayOfYear,Quantity,Fraction,Category,SubCategory
1,82,0.390392720794458,"(Unknown)","(Unknown)"
2,78,0.3713
Hi everyone,
I want to score a set of data (-ve to +ve) using a 0-10 scale. I have the
data in an R matrix, so I need to add another column, containing the scores
and resave.
I would be grateful for suggestions on how best to do this.
Thanks,
rcoder
--
View this message in context:
http://ww
Dear R-helpers,
I tried the playwith packages for the first time, and it crashed R:
> require(playwith)
Loading required package: playwith
Loading required package: lattice
Loading required package: grid
Loading required package: gWidgets
Loading required package: gWidgetsRGtk2
Loading required
It seems the R console took them out. Here is hat I tried:
> for(i in 1:length(sc))
+ {
+ sum(sc[[i]]]$Quantity)
Error: unexpected ']' in:
"{
sum(sc[[i]]]"
> }
Error: unexpected '}' in "}"
>
>
>
What I entered is in the sum that is after the '+'
Thank you.
Kevin
jim holtman <[E
Solved. I tried to create a minimal example, but my script is too
complicated to just cut out lines (too many dependencies). Instead of
it, I sketch
my idea. I do not say it is the nicest solution, but it works as I wanted.
The first five rows of my data-matrix:
> data_svd$u[1:5,]
Hi,
I have an list() like this:
$VAR1
Num Perc media stdev min P5P10P25
1 4381 56.35 181.35 39.81 87.13 123.05 132.59 152.95
2 1628 20.94 192.83 43.76 87.13 125.09 138.78 162.04
3786 10.11 197.23 50.65 88.16 120.46 136.62 159.33
4980 12.60 170.90 38.34 86.98
I think I had an extra '[', ']'.
My mistake on this one.
Thank you.
Kevin
[EMAIL PROTECTED] wrote:
> With my data I get
>
> sc[["(Unknown).{Unknown)"]]
>
> returns NULL
>
> but sc[[1]] returns
>
> DayOfYear Quantity Fraction Category SubCategory
> 1 1 82 3.9039
Hi all,
Does anyone have any tips for extracting chunks of data from a distance matrix?
For instance, if one was interested in only a subset of distance
comparisons (i.e., that of rows 4 thru 6, and no others), is there a
simple way to pull that data out?
>From some playing around with an exampl
Maybe you can use the dput:
x <- list(VAR1 = data.frame(x=rnorm(10), y=rnorm(10)),
VAR2 = data.frame(x=rnorm(10), y=rnorm(10)))
dput(x, file='list.txt')
x <- source('list.txt')[[1]]
On Tue, Jul 15, 2008 at 10:10 AM, Leandro Marino
<[EMAIL PROTECTED]> wrote:
> Hi,
>
> I have an list() l
how about this
f <- as.matrix(dmat)
f[,4:6]
#you get repeats but I think this is what you want
On Tue, Jul 15, 2008 at 9:07 AM, Michael Rennie <[EMAIL PROTECTED]> wrote:
> Hi all,
>
> Does anyone have any tips for extracting chunks of data from a distance
> matrix?
>
> For instance, if one was in
On 15 July 2008 at 17:23, hadley wickham wrote:
| An alternative to enscript is highlight,
| http://www.andre-simon.de/doku/highlight/en/highlight.html, which does
| come with R highlighting built in.
Another alternative is GNU a2ps which has definitions for R source,
documentation and transcript
Dear Leandro,
Another option could be sink(). See ?sink for more information. Here is an
example:
x = list(VAR1 = data.frame(x=rnorm(10), y=rnorm(10)),
VAR2 = data.frame(x=rnorm(10), y=rnorm(10)))
sink("C:/list1.txt")
x
sink()
HTH,
Jorge
On Tue, Jul 15, 2008 at 9:10 AM, Leandro Mari
Not really,
I'd actually want
f[4:6,4:6]
to get comparisons of observations 4 to 6 only. And I'm still left
with the upper triangular matrix. This is a problem since I want to
sum the distances over the blocks that I am extracting.
Then again, I could just divide the sum by two and get the answ
Better late than never, I suppose:
The second column is simply the first column divided by the variance of
the response that have been OOB up to that point (20 trees), times 100.
Best,
Andy
From: David Katz
>
> The verbose option gives a display like:
>
> > rf.500 <-
> + randomForest(new.x,
Dear All,
I am trying to install R 2.7 on my openSUSE 10.3. I have faithfully followed
instruction at http://cran.r-project.org/bin/linux/suse/ReadMe.txt. I have
downloaded all the RPMs but still R complains about:
libtcl8.4.so is needed by R-base-2.7.1-6.1.i586
I searched for this library and
Dear Professor Kubovy
I do not have a Mac to test it on, but please try this:
library(cairoDevice)
Cairo()
grid::grid.newpage()
I expect that you will see a similar crash; if so, it would seem to be
a problem with your GTK+ libraries. I have heard that you need to have
Apple X11 installed (from M
Hello everyone,
Is there any tools to build experimental designs for logistic models?
Thanks,
Jérémy Mazet
Département Génie des procédés
SOREDAB
La Tremblaye
78125 La Boissière Ecole
Tel : 01 34 94 37 09
[[alternative HTML version deleted]]
_
Still the same question:
Birgitle wrote:
>
> I try to use ?randomForest to find variables that are the most important
> to divide my dataset (continuous, categorical variables) in two given
> groups.
>
> But when I plot the outlier:
>
> plot(outlier(rfObject, cls=groupingVariable),
> type="p"
You are not selecting the headers (column names)of a dataframe. You seem to be
creating a new data.frame consisting of those names. It should give you a 1Xn
dataframe.
Is that what you intended to do?
What errors message do you get at V188?
--- On Mon, 7/14/08, Rheannon <[EMAIL PROTECTED]> wr
Hi there,
Does anyone know how to extract elements from the table returned by Manova()?
Using the univariate equivalent, Anova(), it's easy:
a.an<-Anova(lm(y~x1*x2))
a.an$F
This will return a vector of the F-values in order of the terms of the model.
However, a similar application using Manov
Hello all,
I am new to r programmeand need help. I want to do
multiple linear regression analysis. say, I have two matrix 'x' and 'y'. I
want, 'x' as my response variable and 'y' as predictor.
Each time one column of 'x' will be the response, say x[,1], then next x[,2]
and so on.
I am attempting to get publication quality graphs using R on Ubuntu. I
encounter lots of problems in using cex to control font size: for instance
cex=1.5 results in very blocky characters. I then tried to use res=1200
while creating a PNG file, hoping that this would solve the problem, but it
did
That can be accomplished with 8 keystrokes.
A hint is to do the 4 keystrokes:
?lm
Patrick Burns
[EMAIL PROTECTED]
+44 (0)20 8525 0696
http://www.burns-stat.com
(home of S Poetry and "A Guide for the Unwilling S User")
Angila Albaros wrote:
Hello all,
I am new to r programmean
On 15 июл, 13:23, "hadley wickham" <[EMAIL PROTECTED]> wrote:
> An alternative to enscript is
> highlight,http://www.andre-simon.de/doku/highlight/en/highlight.html, which
> does
> come with R highlighting built in.
>
> Hadley
>
Thanks for pointing this out.
But I think I actually need enscript
Any better solution than this ?
sum(strsplit("TCGACAATCGGTAACCCGTCT", "")[[1]] == "G")
_
[[alternative HTML version deleted]]
__
R-help@r-project.org mailing list
https://s
Daren Tan hotmail.com> writes:
> Any better solution than this ?
> sum(strsplit("TCGACAATCGGTAACCCGTCT", "")[[1]] == "G")
Try
table(strsplit("TCGACAATCGGTAACCCGTCT", ""))
A C G T
5 7 8 5
and get all 4 at once.
HTH
--
Ken Knoblauch
Inserm U846
Institut Cellule Souche et Cerveau
D
Seems like you can do:
library("matchprobes") # on Bioconductor
countbases("TCGACAATCGGTAACCCGTCT")[,"G"]
The catch is that it only counts A, C, G, and T:s and no other symbols.
/Henrik
On Tue, Jul 15, 2008 at 8:27 AM, Daren Tan <[EMAIL PROTECTED]> wrote:
>
> Any better solution than this
Maybe
dmat<-dist(dat, method="euclidean",upper = TRUE,diag = TRUE)
can fix your problem with the triangular matrix?
Cheers
Jon
Michael Rennie wrote:
Not really,
I'd actually want
f[4:6,4:6]
to get comparisons of observations 4 to 6 only. And I'm still left
with the upper triangular matrix.
The ecodist package has a convenience function full() that converts a
dist object to a symmetric matrix. After that subsetting works normally.
lower() performs the reverse operation.
Sarah
--
Sarah Goslee
http://www.functionaldiversity.org
__
R-help
Hi Jon,
That only controls the print display of the matrix, not how one can
access the elements. I think my solution revolves around indexing in
as.matrix() with a mind to the fact that results will be duplicated
along the diagonal.
Cheers, and thanks all,
Mike
On Tue, Jul 15, 2008 at 11:43 AM,
Hi,
And the Bioconductor package "Biostrings" is the place to go for any
serious work with sequences.
--
Best wishes
Wolfgang
--
Wolfgang Huber EBI/EMBL Cambridge UK http://www.ebi.ac.uk/huber
15/07/2008 16:43 Henrik Bengtsson
Henrik,
As Wolfgang mentioned, the Biostrings package in Bioconductor has a
number of sequence manipulation functions. The alphabetFrequency
function would get you what you need.
> library(Biostrings)
> alphabetFrequency(DNAString("TCGACAATCGGTAACCCGTCT"))
A C G T M R W S Y K V H D B N - +
are there any packages that calculate stream metabolism.
thanks
Stephen
--
Let's not spend our time and resources thinking about things that are so
little or so large that all they really do for us is puff us up and make us
feel like gods. We are mammals, and have not exhausted the annoying litt
Does anyone know if there is a sunrise sunset calculator for R?
--
Let's not spend our time and resources thinking about things that are so
little or so large that all they really do for us is puff us up and make us
feel like gods. We are mammals, and have not exhausted the annoying little
probl
Hi,
I didn't try automatic dependency resolution instead installed each library one
by one. It seems that tcl is installed and the libtcl8.4.so exists.
Below is the info from the system:
> rpm -q tcl
tcl-8.4.15-22
> whereis libtcl8.4.so
libtcl8.4: /usr/lib64/libtcl8.4.so
> rpm -i R-base-2.7.1-6.
I'm looking to analyze a large data set: a within-Ss 2*2*1500 design
with 20 Ss. However, aov() gives me an error, reproducible as follows:
id = factor(1:20)
a = factor(1:2)
b = factor(1:2)
d = factor(1:1500)
temp = expand.grid(id=id, a=a, b=b, d=d)
temp$y = rnorm(length(temp[, 1])) #generate s
On 7/15/2008 12:52 PM, stephen sefick wrote:
Does anyone know if there is a sunrise sunset calculator for R?
RSiteSearch("sunrise", restrict="function")
points to several related functions in the maptools package.
--
Chuck Cleland, Ph.D.
NDRI, Inc. (www.ndri.org)
71 West 23rd Street, 8th fl
I have a command that reads in some data:
x <- read.csv("Sales2007.dat", header=TRUE)
Then I try to organize the data:
sc <- split(x, list(x$Category, x$SubCategory), drop=TRUE)
Then I want to iterate through the data. I was able to get the following to run
on the R console:
for(i in 1:length
On Tue, 15 Jul 2008 07:08:24 -0700 (PDT)
A Ezhil <[EMAIL PROTECTED]> wrote:
> Dear All,
>
> I am trying to install R 2.7 on my openSUSE 10.3. I have faithfully followed
> instruction at http://cran.r-project.org/bin/linux/suse/ReadMe.txt. I have
> downloaded all the RPMs but still R complains
Daren,
Not sure if it is any easier, but another solution is:
code <- unlist(strsplit("TCGACAATCGGTAACCCGTCT",""))
length(grep("[G]",code))
Steve
-Original Message-
From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]
On Behalf Of Daren Tan
Sent: Tuesday, July 15, 2008 11:28 AM
T
Kevin,
By default, many functions only *return* a result, they don't explicitly
*print* it. There is no difference in interactive mode, but there is in
batch mode (e.g., in loops). Use print() or cat() for explicit printing
to console.
for(i in 1:100)
{
cat(i,"\n")
}
HTH,
Stephan
[EMA
Is there a way to use a time zone independant in the sunriset function. We
have kept our instruments on eastern standard time. Any help would be
great!
On Tue, Jul 15, 2008 at 1:06 PM, Chuck Cleland <[EMAIL PROTECTED]>
wrote:
> On 7/15/2008 12:52 PM, stephen sefick wrote:
>
>> Does anyone know
On Tue, Jul 15, 2008 at 10:25 AM, Patrick Burns
<[EMAIL PROTECTED]> wrote:
> That can be accomplished with 8 keystrokes.
> A hint is to do the 4 keystrokes:
> ?lm
Umm - unless you are counting the implicit , that's only 3
keystrokes isn't it?
> Angila Albaros wrote:
>>
>> Hello all,
>>
[EMAIL PROTECTED] wrote:
I have a command that reads in some data:
x <- read.csv("Sales2007.dat", header=TRUE)
Then I try to organize the data:
sc <- split(x, list(x$Category, x$SubCategory), drop=TRUE)
Then I want to iterate through the data. I was able to get the following to run
on the R
for(1 in 1:10)
{
print(i)
}
Mike
On Tue, Jul 15, 2008 at 1:11 PM, <[EMAIL PROTECTED]> wrote:
> I have a command that reads in some data:
>
> x <- read.csv("Sales2007.dat", header=TRUE)
>
> Then I try to organize the data:
>
> sc <- split(x, list(x$Category, x$SubCategory), drop=TR
library(maptools)
RM215 <- matrix(c(33.5959109, -82.1461363), nrow=1)
RM215.sp <- SpatialPoints(RM215, proj4string=CRS("+proj=longlat
+datum=WGS84"))
d060101 <- as.POSIXct("2006-01-01")
study_seq <- seq(from=d060101, length.out=761, by="days")
up <- sunriset(RM215, study_seq, direction="sunrise", P
Oops, typo- sorry, should be
for(i in 1:10)
{
print(i)
}
Mike
On Tue, Jul 15, 2008 at 1:39 PM, Michael Rennie <[EMAIL PROTECTED]> wrote:
> for(1 in 1:10)
> {
> print(i)
> }
>
> Mike
>
> On Tue, Jul 15, 2008 at 1:11 PM, <[EMAIL PROTECTED]> wrote:
>> I have a command th
If you read the help page, ?for, you might have seen under "Value", that
'for', 'while' and 'repeat' return the value of the last
expression evaluated (or 'NULL' if none was), invisibly.
So if you want to see the values, print() them.
In general, from the first part of your message, i
willemf wrote on 07/15/2008 08:42 AM:
I am attempting to get publication quality graphs using R on Ubuntu. I
encounter lots of problems in using cex to control font size: for instance
cex=1.5 results in very blocky characters. I then tried to use res=1200
while creating a PNG file, hoping that th
Douglas Bates wrote:
On Tue, Jul 15, 2008 at 10:25 AM, Patrick Burns
<[EMAIL PROTECTED]> wrote:
That can be accomplished with 8 keystrokes.
A hint is to do the 4 keystrokes:
?lm
Umm - unless you are counting the implicit , that's only 3
keystrokes isn't it?
You give away that you're an Em
Dear Friends,
INSEED announces following workshop this year.
"Bayesian statistics using OpenBUGS and R" to be organised at the
Department of Statistics, St. Thomas College, Pala, Kerala from 08-12
December, 2008. This is the second workshop of its kind.
For details, see the workshop website
http
Dear Michael,
Does it work for you?
tear <- c(6.5, 6.2, 5.8, 6.5, 6.5, 6.9, 7.2, 6.9, 6.1, 6.3,
6.7, 6.6, 7.2, 7.1, 6.8, 7.1, 7.0, 7.2, 7.5, 7.6)
gloss <- c(9.5, 9.9, 9.6, 9.6, 9.2, 9.1, 10.0, 9.9, 9.5, 9.4,
9.1, 9.3, 8.3, 8.4, 8.5, 9.2, 8.8, 9.7, 10.1, 9.2)
opacity <- c(4.4,
Dear Friends,
INSEED announces following workshop this year.
"Statistical Models and Practices in Epidemiology (using R)" to be
organised jointly with the Department of Statistics, Manipal University,
Karnataka from 24-28 November, 2008. For details, see the
workshop website http://www.inseed.org
# I am sure that I could be more efficient than this but how? Thanks in
advance.
#GPS in Decimal Degrees in the form longitude latitude
RM215 <- matrix(c(-82.1461363, 33.5959109), nrow=1)
SC <- matrix(c(-82.025888, 33.606454), nrow=1)
RM202 <- matrix(c(-81.9906723, 33.5027653), nrow=1)
RM198 <- m
Sorry I missed the print part. When nothing was output I assumed that nothing
happened.
Thank you.
Kevin
Erik Iverson <[EMAIL PROTECTED]> wrote:
> If you read the help page, ?for, you might have seen under "Value", that
>
> 'for', 'while' and 'repeat' return the value of the last
>
Thank you.
?for just gives me a + rompt indicating that I need to supply more input. The
same with ?while and ?repeat. Help(for) yelds:
> help(for)
Error: unexpected ')' in "help(for)"
But thanks for the tip.
Keivn
Erik Iverson <[EMAIL PROTECTED]> wrote:
> If you read the help page, ?f
RM215.sp <- SpatialPoints(RM215, proj4string=CRS("+proj=longlat
+datum=WGS84"))
d060101 <- as.POSIXct("2006-01-01", tz="EST")
study_seq <- seq(from=d060101, length.out=761, by="days")
up.215 <- sunriset(RM215.sp, study_seq, direction="sunrise",
POSIXct.out=TRUE)
down.215 <- sunriset(RM215.sp, study
R 2.7, WinXP
Hi, I am interested in estimating the spatial autoregressive lag model
y = rWy +Xb + e
where W is a square matrix of weights, r an autocorrelation parameter, b
a vector of coefficients, X a matrix of covariates.
There are several packages in R that can estimate this model (sna,
spde
Try this:
format(down.215$time, "%H:%M:%S")
On Tue, Jul 15, 2008 at 4:50 PM, stephen sefick <[EMAIL PROTECTED]> wrote:
> RM215.sp <- SpatialPoints(RM215, proj4string=CRS("+proj=longlat
> +datum=WGS84"))
> d060101 <- as.POSIXct("2006-01-01", tz="EST")
> study_seq <- seq(from=d060101, length.out=76
sorry this should work
On Tue, Jul 15, 2008 at 3:50 PM, stephen sefick <[EMAIL PROTECTED]> wrote:
RM215 <- matrix(c(-82.1461363, 33.5959109), nrow=1)
> RM215.sp <- SpatialPoints(RM215, proj4string=CRS("+proj=longlat
> +datum=WGS84"))
> d060101 <- as.POSIXct("2006-01-01", tz="EST")
> study_seq <- s
Hi wf
>> I just cannot believe that R does not have a good command of this.
Curious. I find R's graphical output matchless. Almost without exception I
use postscript and find the controls available under base graphics (?par) or
"lattice" adequate (to understate). Very occassionally I fiddle with
Sorry, I'm in ESS.
Try ?Control
[EMAIL PROTECTED] wrote:
Thank you.
?for just gives me a + rompt indicating that I need to supply more input. The
same with ?while and ?repeat. Help(for) yelds:
> help(for)
Error: unexpected ')' in "help(for)"
But thanks for the tip.
Keivn
Erik Iverso
> -Original Message-
> From: [EMAIL PROTECTED]
> [mailto:[EMAIL PROTECTED] On Behalf Of
> [EMAIL PROTECTED]
> Sent: Tuesday, July 15, 2008 12:40 PM
> To: Erik Iverson
> Cc: [EMAIL PROTECTED]
> Subject: Re: [R] Iterations
>
> Thank you.
>
> ?for just gives me a + rompt indicating that I
I'm coming from the AMOS world and am wondering if there is a simple
way to do multiple hypothesis testing in the manner of BIC analyses in
AMOS using the sem package in R. I've read the documentation, but
don't see anything in there except for basic BIC scores. Perhaps
someone has devised a simp
Thanks to everyone for the help and advice! It turns out that my problem was
using $HOME in the .First function in Rprofile.site. Since $HOME is a user
specific variable, it seems to have crashed when running from the
$R_HOME/etc/ directory. I added the other .Rprofile files without deletng
the Rpr
I am just starting to use R language, and jumped into using svm (e1071) model
to do classification analysis using svm. Meanwhile, I used 10-fold cross
validation to evaluate initial classification accuracy. Now I am going to
run for example 100 times cross validation to determine the distribution
Thank you Jeff, I will follow up on this. I just cannot believe that R does
not have a good command of this. The obvious route is Postscript ourput,
since it is not raster-based and one can incorporate EPS files into
OpenOffice documents. However, when printing to a Postscript device, there
is no
Thank you both.
I managed to accomplish this tack with your help.
date = ts(time, start =1985, freq =4)
quarters = as.Date(time(date))
z = length(quarters)
win.graph()
par(mfrow=c(1,1),mex=0.7,bg="white")
matplot(1:n,corp.check,type="l",lty=1, col=2, ylab="$",xlab="",xaxt="n")
title(main="C
willemf wrote on 07/15/2008 08:42 AM:
> I am attempting to get publication quality graphs using R on Ubuntu. I
> encounter lots of problems in using cex to control font size: for instance
> cex=1.5 results in very blocky characters. I then tried to use res=1200
> while creating a PNG file, hoping t
On Jul 15, 2008, at 8:16 AM, rcoder wrote:
Hi everyone,
I want to score a set of data (-ve to +ve) using a 0-10 scale. I
have the
data in an R matrix, so I need to add another column, containing
the scores
and resave.
Hi,
I am a little fuzzy on what you are asking, but my guess is th
Dear all,
I
have a grid of 720 columns by 360 rows of global population density
values, and hope to convert this to column format using the 'melt' command in
the 'reshape' package. I'm not receiving
any errors as such, but when the code has finished running, my output
looks like this:
> head(P
I have a command which returns a data fram if I am not mistaken:
sc <- split(x, list(x$Category, x$SubCategory), drop=TRUE)
Now I wish to get the Category and SubCategory that the data was split on. So
my first attempt would be:
sc[[1]]$Category[1]
But that yields
[1] (Unknown)
46 Levels: (U
For some reason, cairoDevice has been crashing the Mac for a while. It has
something to do with the rotation of text through Pango. That's all I've
been able to determine. Kind of tough without access to a Mac... but it DID
work once upon a time..
2008/7/15 Felix Andrews <[EMAIL PROTECTED]>:
> De
1 - 100 of 132 matches
Mail list logo
