Re: [R] reading a string vector

2010-01-26 Thread bia.estat
thanks, it was exactly what i needed. -- View this message in context: http://n4.nabble.com/reading-a-string-vector-tp1290289p1310721.html Sent from the R help mailing list archive at Nabble.com. __ R-help@r-project.org mailing list https://stat.ethz.

Re: [R] reading a string vector

2010-01-26 Thread Henrique Dallazuanna
Try this: strsplit("atgctctaatcgtcccaacaattatattactaccac", NULL) On Tue, Jan 26, 2010 at 11:08 AM, bia.estat wrote: > > Hi, I need to read a string vector in R which is like this > "atgctctaatcgtcccaacaattatattactaccac", but R seems to understand it as > a unique vector input when I read

Re: [R] reading a string vector

2010-01-26 Thread Romain Francois
On 01/26/2010 02:08 PM, bia.estat wrote: Hi, I need to read a string vector in R which is like this "atgctctaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x<- "atgctctaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I

Re: [R] reading a string vector

2010-01-26 Thread Ista Zahn
Like this? strsplit("atgctctaatcgtcccaacaattatattactaccac", split="") -Ista On Tue, Jan 26, 2010 at 8:08 AM, bia.estat wrote: > > Hi, I need to read a string vector in R which is like this > "atgctctaatcgtcccaacaattatattactaccac", but R seems to understand it as > a unique vector input w

[R] reading a string vector

2010-01-26 Thread bia.estat
Hi, I need to read a string vector in R which is like this "atgctctaatcgtcccaacaattatattactaccac", but R seems to understand it as a unique vector input when I read in like x <- "atgctctaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I can use each of the letters on my readin