On 08/31/2011 01:36 AM, anyone wrote:
Hi there,
I have large excel files which I can save as CSV files.
Each excel file contains two columns. One contains the chromosome number and
the second contains a DNA sequence.
I need to convert this into a fasta file that looks like this
chromosomenumb
> Date: Wed, 31 Aug 2011 01:36:51 -0700
> From: oliviacree...@gmail.com
> To: r-help@r-project.org
> Subject: [R] Convert CSV file to FASTA
>
> Hi there,
>
> I have large excel files which I can save as CSV fi
Hi there,
I have large excel files which I can save as CSV files.
Each excel file contains two columns. One contains the chromosome number and
the second contains a DNA sequence.
I need to convert this into a fasta file that looks like this
>chromosomenumber
CGTCGAGCGTCGAGCGGAGCG
Can anyon
3 matches
Mail list logo