Sorry, I meant
`[.gene`
where gene would be your new class.
-s
On Wed, Dec 24, 2008 at 11:00 AM, Stavros Macrakis wrote:
> You might consider using the 'bit' library and use two bits per base. You
> could then wrap this in an object with appropriate functions (bit.`[`,
> etc
Since you only have 4 characters, you can can create a table of all
the combinations of 4 of them and this will reduce to one byte instead
of 4. This is fine if you just want to store them.
> x <- expand.grid(c("A","C","G","T"),
+ c("A", "C", "G", "T"),
+ c("A", "C", "G", "T"),
+ c("A
You might consider using the 'bit' library and use two bits per base. You
could then wrap this in an object with appropriate functions (bit.`[`,
etc.).
-s
On Wed, Dec 24, 2008 at 10:26 AM, Gundala Viswanath wrote:
> Dear all,
>
> What's the R way to compress the string into smaller 2
Dear all,
What's the R way to compress the string into smaller 2~3 char/digit length.
In particular I want to compress string of length >=30 characters,
e.g. ACGATACGGCGACCACCGAGATCTACACTCTTCC
The reason I want to do that is because, there are billions
of such string I want to print out. And I ne
4 matches
Mail list logo
