Re: [R] Test if data uniformly distributed (newbie)

Kolmogorov-Smirnov-test would be a better fit. I came across one of your threads on the internet where you answer a similar question and thought I'd reach out to you. Thanks in advance Florian Huber Diese Nachricht einschliesslich etwa beigefuegter Anhaenge ist vertraulich und kann dem

[R] AER ivreg diagnostics: question on DF of Sargan test

of freedom Multiple R-Squared: 0.2868, Adjusted R-squared: 0.2854 Wald test: 178.6 on 6 and 2990 DF, p-value: < 2.2e-16 Would this be caused by the fact that I'm using 2SLS and not GMM (at least I suppose) to estimate the IV model ? I apologize if this comes from a misunderstanding fro

[R] color lines by group membership in spaghetti plot

color scheme in the legend? Any advice would be much appreciated. Jack Jack B. Monpas-Huber, Ph.D. Director of Assessment & Student Information Shoreline Public Schools 18560 1st Ave NE Shoreline, WA 98155 (206) 368-4774 Office (206) 947-9926 Cell Shoreline Assessment Web site My

Re: [R] problem using cat within Sweave code chunks when fig=TRUE

Hi Paul, You could <>= plot(1:10) @ <>= cat("figure1.eps caption goes here \n",file="readme.txt",append=T) cat("figure1.pdf caption goes here \n",file="readme.txt",append=T) @ You can suppress one of the three executions by setting eps=FALSE in the code chunk options or in the document-wide \

Re: [R] mapping a vector into predefined bins

Have a look at ? cut Best wishes Wolfgang -- Wolfgang Huber EBI/EMBL Cambridge UK http://www.ebi.ac.uk/huber 22/08/2008 14:14 Dr. G. Lawyer scripsit >Hi, >I have a mapping M consisting of a vector of bin c

Re: [R] counting number of "G" in "TCGGGGGACAATCGGTAACCCGTCT"

Hi, And the Bioconductor package "Biostrings" is the place to go for any serious work with sequences. -- Best wishes Wolfgang -- Wolfgang Huber EBI/EMBL Cambridge UK http://www.ebi.ac.uk/huber 15/07/2008 16

Re: [R] question about a small "for" loop

ge", i, sep="^")]] = jaw$age^i or m = outer(jaw$age, 2:6, "^") colnames(m) = paste("age", 2:6, sep="^") jaw = cbind(jaw, m) Best wishes Wolfgang -- ---- Wolfgang Huber, EMBL-EBI, http://www.ebi.ac.u

Re: [R] Analysis of poorly replicated array data

/iss1/art3 [2] Differential Expression with the Bioconductor Project Anja von Heydebreck, Wolfgang Huber, Robert Gentleman http://www.bepress.com/bioconductor/paper7 Best wishes Wolfgang -- ---- Wolf

Re: [R] Subsetting an array by a vector of dimensions

[<-" also when it is called with do.call? Best wishes Wolfgang ---- Wolfgang Huber, EMBL-EBI, http://www.ebi.ac.uk/huber On Sat, Jul 12, 2008 at 12:48 AM, Wolfgang Huber <[EMAIL PROTECTED] <mailto:[EMAIL PROTECTED]>> wrote: Hi Richard,

Re: [R] Subsetting an array by a vector of dimensions

optimized to avoid that in some cases. Try x=numeric(1e6); system.time({for (i in 1:1000) x[i]=12}) versus x=numeric(1e6); system.time({for (i in 1:1000) {y=x; y[i]=12}}) Best wishes Wolfgang ---- Wolfgang Huber, EMBL-EBI, http

Re: [R] strange (to me) p-value distribution

, 1:10] = x[, 1:10] + pi/2 rt2 = rowttests(x, factor(1:nc %% 2)) par(mfrow=c(2,1)) hist(rt1$p.value, breaks=100, col="mistyrose") hist(rt2$p.value, breaks=100, col="mistyrose") ------ Wolfgang Huber EBI/EMBL Cambridge UK

Re: [R] Concatenate variables and quoted text for output filenames

printf("%d-%d_plot.png", i, j)) -- Best wishes Wolfgang ------ Wolfgang Huber EBI/EMBL Cambridge UK http://www.ebi.ac.uk/huber __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting gui

Re: [R] change column names of several data frames

Hi Henrik, afaIcs this should work: for(v in sprintf("data.%d", 1:n)) { f = get(v) names(f) = whatever assign(v, f) } -- Best wishes Wolfgang -- Wolfgang Huber EBI/EMBL Cambridge UK http://www.ebi.ac.uk/hube

Re: [R] A question on getting all possible combinations

library("R.utils") intToBin(0:63) Best wishes Wolfgang -- Wolfgang Huber EBI/EMBL Cambridge UK http://www.ebi.ac.uk/huber Benilton Carvalho scripsit: > target = c("u", "d") > apply(expand.

Re: [R] Dendrogram for agglomerative hierarchical clustering result

Hi Risto, You could try example("dendrogram") best wishes Wolfgang noorpiilur scripsit: > Hey group, > > I have a problem of drawing dendrogram as the result of my program > written in C. My algorithm is a approximation algorithm for single > linkage method. AS a result I will get th

Re: [R] shortest distance between two point pattern

R/e4/devel/08/01/0158.html Best wishes Wolfgang -- Wolfgang Huber EBI/EMBL Cambridge UK http://www.ebi.ac.uk/huber __ R-help@r-project.org mailing list https://stat.ethz.ch/mail

Re: [R] shortest distance between two point pattern

eighbor search algorithms, but I am not aware whether or where in R.). This one works well for medium sized problem as in your example. Best wishes Wolfgang -- Wolfgang Huber EBI/EMBL Cambridge UK http://www.ebi.ac.uk/huber Milto

Re: [R] Multi-dimensional function.

José Luis Aznarte M. ha scritto: > Hi there! Happy new year to everyone! > There's a piece of code that I must write that's driving me crazy. > Maybe any of you has previous experiences in something similar. Any help > will be greatly appreciated! > > The problem is as follows. I hav

Re: [R] Wilcoxon Rank test

the null-hypothesis can be rejected. Best wishes Wolfgang -- Wolfgang Huber EBI/EMBL Cambridge UK http://www.ebi.ac.uk/huber Baqueiro ha scritto: > Greetings, I am trying to perform a Mann-Whitney U test to a pair of >