I did use library(binom). However, I was able to use the method "lrt" which is
short for likelihood ratio test.
-Original Message-
From: Jim Lemon [mailto:drjimle...@gmail.com]
Sent: Thursday, September 13, 2018 11:50 PM
To: Guo, Fang (Associate) ; r-help mailing list
Subje
I used library(binom).
-Original Message-
From: Bert Gunter [mailto:bgunter.4...@gmail.com]
Sent: Thursday, September 13, 2018 10:04 PM
To: Guo, Fang (Associate)
Cc: r-help-requ...@r-project.org; R-help
Subject: Re: [R] Question on Binom.Confint
In what package?
Binomial confidence
It's method="lrt" and I used the "binom" package.
-Original Message-
From: Rolf Turner [mailto:r.tur...@auckland.ac.nz]
Sent: Thursday, September 13, 2018 10:02 PM
To: Guo, Fang (Associate)
Cc: r-help@R-project.org
Subject: Re: [FORGED] [R] Question on Binom.C
Hi,
I have a question with the function Binom.Confint(x,n,"method"=lrt). For
likelihood ratio test, I'd like to ask how you define the upper limit when the
frequency of successes is zero. Thanks!
Fang Guo
Associate
CORNERSTONE RESEARCH
699 Boylston Street, 5th Floor
Boston
ts web app,
XGR is able to provide a user-friendly tool for exploring genomic relations
at the gene, SNP and genomic region level.
Best regards,
Dr Hai Fang
Wellcome Trust Centre for Human Genetics
University of Oxford
Roosevelt Drive Headington
Oxford OX3 7BN
[[alternative HTML versi
oduce them individual
topics in the form of FAQs (http://dnet.r-forge.r-project.org/faqs.html).
Enjoy it!
Hai Fang, Ph.D.
>From Prof. Gough's Group (http://bioinformatics.bris.ac.uk)
Department of Computer Science
Univeristy of Bristol
Bristol, United Kingdom
hf...@cs.bris.ac.uk
http:/
Dear R colleagues,
I am a newbie to R. I can not figure out how to compute Ln(x) value in R.
My question may be so easy for you but I will really appreciate if you can
help me. Thanks so much for your time!
Kathy
[[alternative HTML version deleted]]
If you look at the new file in raw mode, you'll see that it's chock full of
ASCII nuls, while the old file has none. This is probably what's giving you
the problems, because R does not allow strings containing embedded nul
characters. (I believe this is because Nul in strings is pretty dangerous in
I'm not sure what you are trying to prove with that example - the loopless
versions are massively faster, no?
I don't disagree that loops are sometimes unavoidable, and I suppose
sometimes loops can be faster when the non-loop version e.g. breaks your
memory budget, or performs tons of needless co
For loops are really, really slow in R. In general, you want to avoid them
like the plague. If you absolutely must insist on using them in large,
computationally intense and complex code, consider implementing the relevant
parts in C, say, and calling that from R.
Staying within R, you can probabl
Better yet, remove the which altogether, and it'll run a slight bit faster
and maybe look a little neater.
x <- x[x!="bobo"]
--
View this message in context:
http://r.789695.n4.nabble.com/Remove-a-number-from-a-vector-tp851865p4626413.html
Sent from the R help mailing list archive at Nabble.com.
What about using a Portable Apps style packaging of R? That might solve some
of the issues.
--
View this message in context:
http://r.789695.n4.nabble.com/registry-vulnerabilities-in-R-tp4619217p4623388.html
Sent from the R help mailing list archive at Nabble.com.
___
So, I'm maintaining some else's code, which is as always, a fun thing. One
feature of this code is the use of the 'seek' command.
In ?seek:
We have found so many errors in the Windows implementation of file
positioning that users are advised to use it only at their own
risk, and
I think the question on your mind should be: 'what do I want to do with this
plot'? Just producing output from the PCA is easy - plotting the output$sd
is probably quite informative. From the sounds of it, though, you want to do
clustering with the PCA component loadings? (Since that's mostly what
How many data points do you have?
--
View this message in context:
http://r.789695.n4.nabble.com/What-is-the-most-cost-effective-hardware-for-R-tp4617155p4617187.html
Sent from the R help mailing list archive at Nabble.com.
__
R-help@r-project.org mail
Hi all,
Basically, I have data in the format of (up to 1 gig in size) text files
containing stuff like:
F34060F81000F28055F8A000F2E05EF8F000F34 (...)
The data is basically strings denoting hex values (9 = 9, A = 10, B = 11,
...) organised in fixed, small blocks. What I want to do is to read in a
Dear All,
I run R on a windows 7 machine and it has been worked very well. I installed
Graphvis 2.20.3 and Rgraphviz.
recently, however, I cannot load the Rgraphviz package and error message popped
up
The message shown on the pop up window with the title: R Consol: Rgui.exe -
Sysytem error
Th
Hi all,
I know Chi-squared test can be done with the frequency data by R function
"chisq.test()", but I am not sure if it can be applied to the percentage
data ? The example of my data is as follow:
#
KSL MHL MWS CLGC
Hi all,
I know Chi-squared test can be done with the frequency data by R function
"chisq.test()", but I am not sure if it can be applied to the percentage
data ? The example of my data is as follow:
#
KSL MHL MWS CLGC
Hi all,
While useing the R package "Spatstat" to detect the spatial point pattern of
my data, I met a problem. When I computes simulation envelopes with a
fitted point process model: Poisson cluster (Thomas) process
(kappa=2.751010e-05; sigma=5.634274e+01; mu=4.943639e+02), I cannot get the
high
Hi all,
When I detect the spatial point pattern, I want to use the Cramer-von Mises
statistic to assess the curve-wise significance of deviations from null
hypotheses. Who can tell me which function in R package "Spatstat" can do
this work?
Thanks a lot
Jeff
[[alternative HTML version
Hi all,
I am using "spatstat" to investigate the spatial structure of some plant
populations, but I have no idea about detecting the spatial point pattern
with Thomas process based on pcf. Additionally, generating simulation
envelope using this null model is another problem for me. I am not very
f
Hi all,
I am using "spatstat" to investigate the spatial structure of some plant
populations, and I want to detect these patters with IPP and a Thomas
process based on pair-correlation function. I know the function "pcfinhom"
is available to characterize the IPP, but I have no idea about how to us
Hi,ALL
I want to use R in Perl, the Statistics::R module is great but I meet the
problem: I don`g know how to pass one array from Perl to R, can anyone show me?
Any suggestion will be appreciate~
Thank you!
[[alternative HTML version deleted]]
__
Thank you!
Best wishes,
John
2010/11/13 Alexx Hardt
> Am 13.11.2010 14:50, schrieb John Fang:
>
> Hi all,
>>
>> Is there any one that would give an explanation on the abbreviation SEXP
>> used in R internals to represent a pointer to a data structure?
>>
&
Hi all,
Is there any one that would give an explanation on the abbreviation SEXP
used in R internals to represent a pointer to a data structure?
Thanks!
Best wishes,
John
[[alternative HTML version deleted]]
__
R-help@r-project.org mailing li
Hi,
I am trying to get the indices of non-zero entries of a sparse matrix in R
sr d
1 1089 3772 1
2 1109 190 1
3 1109 2460 1
4 1109 3071 1
5 1109 3618 1
6 1109 38 1
I found that the following can create a sparse matrix,
library(Matrix)
Y <- sparseMatrix(s,r,x=d)
but have not idea a
7;s, i.e. without considering N, which strings are the same.
But actually, the match I planned is position-to-position match, i.e.
1st and 2nd strings are the same except for the N's
So, the expected output is 1 1 2 2 3 2 4
Please advice.
Thanks!
--gang
On Wed, Jun 23, 2010 at 7:55 PM, Ma
Hi,
I want to group a large list (20 million) of strings into categories
based on string similarity?
The specific problem is: given a list of DNA sequence as below
ACTCCCGCCGTTCGCGCGCAGCATGATCCTG
ACTCCCGCCGTTCGCGCGC
CAGGATCATGCTGCGCGCGAACGGCGGGAGT
CAGGATCATGCTGCGCGCGAANN
CAGG
> On Jun 21, 2010, at 9:18 PM, Duncan Murdoch wrote:
>>
>>> On 21/06/2010 9:06 PM, G FANG wrote:
>>>>
>>>> Hi,
>>>>
>>>> I want to get the unique set from a large numeric k by 1 vector, k is
>>>> in tens of millions
>&
Hi,
I want to get the unique set from a large numeric k by 1 vector, k is
in tens of millions
when I used the matlab function unique, it takes less than 10 secs
but when I tried to use the unique in R with similar CPU and memory,
it is not done in minutes
I am wondering, am I using the function
Hi,
I have been a matlab user and is learning R.
I want to convert a large list of strings to a list of unique numeric
ids to reduce storage space.
For example,
there is a string list (there are duplicates)
ABC
ACCDEDF
ACCGEDF
ACCGEGF
.
ACCDEDF
ACCGEGF
and I want to have a correspondi
I am developing a S4 class but have had trouble to make setMethod work
in Window 7. I tested an example found in the setMethod manual:
> require(graphics)
> setMethod("plot", signature(x="track", y="missing"),
+ function(x, y, ...) plot(slot(x, "x"), slot(x, "y"), ...)
+ )
It gave
Thanks for your help. Finally, I got it.
From: Dennis Murphy [mailto:djmu...@gmail.com]
Sent: Friday, February 05, 2010 12:20 PM
To: Fang (Betty) Yang
Cc: r-help@r-project.org
Subject: Re: [R] sum a particular column by group
Hi:
This is not an elegant solution by any means, but it gets
Dear all,
I have a table like this:
> eds
R.ID Region Gender Agegr Time nvisits
11 A F 60--64 1:00 1
22 OF 55--591:20 1
33 OF 55--59 3:45 3
44 S
the NAMESPACE file, right? The question I was wondering was what
the appropriate way to document this operator is. i.e. What should I
put in the \usage section, etc?
'Writing R Extensions' doesn't seem to see much about this, but maybe
I'm m
Dear all,
I am struggling with a small problem. By using aggregate, the empty subsets
are removed. I need each empty subset to be 0. Any suggestions will be
appreciated.
Code:
edref = aggregate(rep(1,times=dim(eds)[1]),list(eds[,11], eds[,7],
eds[,27]), sum)
Thanks in advance,
Dear all.
I have a data matrix that each row containing a specific individual's
information including individual observation and properties. I'm trying to
use R to create some bootstrap samples with this data matrix. I have tried the
boot() function in boot package, but it seems that this fu
Dear all,
I'd like to ask help on R code to get the same results as the following
Splus code:
>indata<-importData("/home/data_new.csv")
>indata[1:5,4]
[1] 0930 1601 1006 1032 1020
I tried the following R code:
> indata<-read.csv("/home/data_new.csv")
> indata[1:5,4]
[1] 9
Dear all,
I am writing to ask for help to find R code to do the same thing as the
following Splus code:
dates <- c("02/27/1992", "02/27/1992", "01/14/1992", "02/28/1992",
"02/01/1992")
timeDate(as.character(dates),in.format="%m/%d/%Y","%a")
[1] Thu Thu Tue Fri Sat
Could anyone give me
Oh hang on, I've figured it out.
Rounding error, doh. Somewhere along the line I got lazy and took the
weighted average of two values that are equal. as.integer truncates, so,
yeah. Never mind.
Zhou Fang
__
R-help@r-project.org mailing list
ested in a R workspace to reproduce this, email me.
This is running in R 2.9.
Zhou Fang
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provi
to me. You get a number between zero and
one out of it, with 1 the solution for constant fits. Anyone seen
anything like this, or know anything about properties? Has it got a
name?
Zhou Fang
__
R-help@r-project.org mailing list
https://stat.ethz.
n' actually does? Or what the
justification for it is? Or when it would be necessary? Is there a paper
I can look at?
And is the feature likely to emerge from 'experimental' any time soon?
Zhou Fang
__
R-help@r-project.org mailin
Thanks! That does exactly what I want. (Heck, maybe this should be
included as a default sorted alternative to ave.)
I was thinking of doing it another way using cumsums, but maybe this
method is faster.
Zhou
__
R-help@r-project.org mailing list
https:
very slow, and certainly not suited to
my problem, where Y changes and X stays the same and I need to
repeatedly recalculate the averaging of Y. Ave also does not take take
advantage of the sorting of the data.
So, is there an alternative? (Presumeably avoiding loops.)
Thanks,
Ah ha, that does work.
What do you mean it isn't robust, though? I mean, obviously linear
dependency structures in general are not stable under small
perturbations...?
Or is it that it's platform dependent?
Zhou
On Fri, Feb 6, 2009 at 2:28 PM, Peter Dalgaard wrote:
> Zhou Fang
have the QR decomposition of the original X 'for free'.
I know that it's possible to do this directly by looping over the
columns and adding them, but at the very least, a solution without
horrible slow loops would be nice.
Any ideas welc
What are you trying to do with
> for (pp in 1:pp+1){
?
Also, note that 1:rr+1 and 1:(rr+1) mean different things.
Zhou
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-proj
raphs. The
downside is that you might get lured into complacency...
Zhou Fang
PS: Your model equation isn't right. In both, we are also allowing the
intercept to vary between groups. So really you want
y = c + D.b0 + b1.x + D.b2.x
__
R-help@r-proj
raphs. The
downside is that you might get lured into complacency...
Zhou Fang
PS: Your model equation isn't right. In both, we are also allowing the
intercept to vary between groups. So really you want
y = c + D.b0 + b1.x + D.b2.x
__
R-help@r-proj
Hi all,
As a possibly silly request, is it possible to interactively pause a
R-calculation and do a browser(), say, without browser or other debug
handlers being explicitly included in the code?
Imagine the following situation:
You write up a big calculation for R to calculate. We are talking
ho
t you wish to work on and start R normally.
> No code is needed.
>
> On Mon, Jan 12, 2009 at 10:04 AM, Zhou Fang wrote:
>> Ok, looks like I can do what I want with --args, commandArgs() and an
>> appropiate .First.
>>
>> Thanks,
>>
>> Zhou
>>
>
;
> -- David Winsemius
>
> On Jan 12, 2009, at 7:24 AM, Zhou Fang wrote:
>
>> That's not really what I meant by 'command line'. I meant, well,
>> loading from e.g. a bash shell, not from within an interactive R
>> session itself.
>>
>>
te:
> See ?load
>
> On Mon, Jan 12, 2009 at 10:12 AM, Zhou Fang wrote:
>>
>> Hi,
>>
>> Is there any way to load workspaces (e.g. stuff from save.image) from
>> the command line? I'm on Linux, and would find this very helpful.
>>
>> I'm gue
ates), but I'm wondering if there's a better way.
Zhou Fang
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide comm
Hi,
Should be a quickie:
I want to make a datafile in R for plotting in gnuplot (which has
friendlier 3D plotting options, as far as I can tell). So, I want to
create a file with contents along the lines of
#File begins
0 0 10
0 13 10
0.2 2 10
1 0 10.12
1 1 5
1 2 10
2 0 10
2 1 1
2 2 10
It's p
subset size is likely small,
though), so things like combn don't seem to be a good solution. The biggest
concern is keeping memory usage sane, but processing time is also fairly
important.
Any ideas?
Zhou Fang
__
R-help@r-project.org mailing
Hi,
Can you tell me what is the meaning for "tail, 1" in "aggregate"?
I also want to get some similar graph, but the data is not time series data.
Suppose here is my data one, I want a graph with x-axis is just the
index(1:9).
The graph plot all the variable A, B,C,D. So there should be 4 lines f
Hi,
I got a problem. I am trying to find "p" in binomial.
X~bin(n, p)
I want to find value "p", so that Pr(X <= k) <= alpha.
Here, n, k are known.
Thank you for helping me with this!
Catherine
_
[[replacing trailing spam]]
___
60 matches
Mail list logo