[R] Why daisy() in cluster library failed to exclude NA when computing dissimilarity

Hi, According to daisy function from cluster documentation, it can compute dissimilarity when NA (missing) value(s) is present. http://stat.ethz.ch/R-manual/R-devel/library/cluster/html/daisy.html But why when I tried this code library(cluster) x <- c(1.115,NA,NA,0.971,NA) y <- c(NA,1.006,NA,N

Re: [R] wmf screen resolution problem!!!

On 07/12/2013 12:46, Venkat Karthik wrote: Dear colleagues, For the past two weeks we have been struggling to create a proper image with stable pixels, height & width from R for various screen resolutions. You cannot do that: it is a function of the format and how Microsoft's GDI works. We

[R] computational cost of the survpack or survival support vector machine package

Dear All, I'm trying using the survpack to apply support vector machines on survival analysis, but I find that it's very slow. I use a data frame with 1082 rows and 8 columns but it seems to run forever... Does anyone have any insight or suggestion to this or have better knowledge of another R pac

[R] combine glmnet and coxph (and survfit) with strata()

Dear All, I want to generate survival curve with cox model but I want to estimate the coefficients using glmnet. However, I also want to include a strata() term in the model. Could anyone please tell me how to have this strata() effect in the model in glmnet? I tried converting a formula with stra

Re: [R] ANOVA in R

I think you start by doing your homework: 1. Read "An Inroduction to R" (ships with R) or other R online tutorial. There are many good ones. 2. Use R's Help system: ?aov ?lm ?anova there will be relevant links in these docs that you should follow, especially to the use of formulas for model spec

[R] ANOVA in R

ID a_t1a_t2b_t1b_t2 CACCCGTAGAACCGACCTTGCG_mmu-miR-99b-5p15781941234810941 CACCCGTAGAACCGACCTTGC_mmu-miR-99b-5p4424265643839 CACCCGTAGAACCGACCTTG_mmu-miR-99b-5p544366253 CCGTAGAACCGACCTTGCG_mmu-miR-99b-5p263333157 CGTAGAAC

[R] How to perform clustering without removing rows where NA is present in R

I have a data which contain some NA value in their elements. What I want to do is to **perform clustering without removing rows** where the NA is present. I understand that `gower` distance measure in `daisy` allow such situation. But why my code below doesn't work? __BEGIN__ # plot heat map

[R] wmf screen resolution problem!!!

Dear colleagues, For the past two weeks we have been struggling to create a proper image with stable pixels, height & width from R for various screen resolutions. We are trying to generate a wmf image with fixed pixels, fixed height & fixed width. But the problem we are facing is that when the sa

Re: [R] tune an support vector machine

UPDATE This line of code will produce what i desired, i will check if the tuning of the svm works as i planed and post the solution asap l <- apply(head(namen, -1), 1, function(x) reformulate(paste(na.omit(x), collapse = "+"), response = "type")) l[[1]] svm

Re: [R] tune an support vector machine

Thank you very much, your proposal is one practical way to check for significant features. I tried to check for all combination in a loop, but unfortunately there is a problem with NA values. Maybe anybody has an idea. This is my expansion of the former code: namen<-expand.