Hi
r-help-boun...@r-project.org napsal dne 26.06.2010 00:11:33:
> Albert -
> The message refers to a file specifically called ".RData".
> Files with subscripts of .rdata are not related.
> You can see your current working directory by typing
>
> getwd()
>
> at the R prompt.
>
> I'
Derek,
As a general strategy, and as an alternative to parscale when using optim, you
can just estimate the logarithm of your parameters. So in optim the par
argument would contain the logarithm of your parameters, whereas in the model
itself you would write exp(par) in the place of the paramet
Hi, take the following example and proceed accordingly.
Name=c("Miller","Miller","Miller","Miller","Smith","Smith","Smith","Smith")
X=rnorm(8)
Year=rep(2000:2003,2)
d=data.frame(Name,X,Year)
#Row indices
rows=1:dim(d)[1]
#Which Name occupies which rows?
#"Name" would be your "file"
w=function(
hello everyone. please bear with me if this is very easy...
I have a data set with many trials, and frames within each trial. I would
like to pull out one random frame from each trial.
here is an example. i have 4 unique trials (file), and various frames within
each (time_pred). I would like to
That achieves the desired alignment, but squishes all of the data in the top
xyplot, which has a maximum y-value of around 50. Any thoughts on a means
of moving the axis without changing the range? Thanks!
On Fri, Jun 25, 2010 at 6:42 PM, Felix Andrews wrote:
> ylim = extendrange(c(0,100)) ?
>
On Jun 25, 2010, at 9:31 PM, Julia Choi wrote:
Dear All:
I have been trying to remove "Inf" values from a series of data
(multiple ratio operations). I have tried the na.rm() function (and
tried this inside mean(), median(), and var()) but this does not
always work. Though the !is.finite
something like
panel = function(x, y, z, ...) {
panel.levelplot(x, y, z, ...)
panel.text(x, y, labels = z)
}
(if you have multiple panels you will need to use 'subscripts' too)
On 25 June 2010 13:16, Ben Wilkinson wrote:
> I am trying to add labels equal to the value in a levelplot. I b
Oh, if you want to put the panels on the same scale, see
resizePanels() from the latticeExtra package.
That does something like
print(xyplot(...), panel.height = list(x = c(50,100), units = "null"))
but figures out the ratios automatically.
-Felix
On 28 June 2010 08:46, David Warren wrote:
> T
On Sun, 27 Jun 2010, Jurica Brajkovi? wrote:
I want to calculate Newey West robust standard error using NeweyWest.
Comparing the results to what I get in STATA, in order to get the same
results in I need to specify "prewhite=0". Can someone explain what this
prewhite command means?
It contro
On 27/06/2010 12:58 PM, Matthew Neilson wrote:
Hi there,
I've written a script for reading 3D simulation data into R, rendering
it using RGL, and then saving the resulting plot using the
snapshot3d() function. The results are fantastic! However, whenever
RGL plots anything it automatically
Jim,
What a great function: exactly as i needed.
I'm sure i'll be finding alot of use for the plotrix package.
Sincere thanks for your fast help, cheers,
Karl
On 6/27/2010 8:52 AM, Jim Lemon wrote:
On 06/26/2010 11:20 PM, Karl Brand wrote:
Dear List,
I'd really appreciate tip's or code dem
Am Sonntag, 27. Juni 2010, 08:39:10 schrieb Prof Brian Ripley:
> On Sun, 27 Jun 2010, Sebastian Gibb wrote:
> > Hello,
> >
> > is there a possibilty in R to convert numbers (double precision, 64bit)
> > into single precision ones (32bit).
> > I need that for compatibility reasons. Until now I call
I want to calculate Newey West robust standard error using NeweyWest. Comparing
the results to what I get in STATA, in order to get the same results in I need
to specify "prewhite=0". Can someone explain what this prewhite command means?
Thanks
[[alternative HTML version deleted]]
http://github.com/armstrtw/unifieddbi
which I use on 64bit linux. you are welcome to test it for 64 bit
windows. are you able to compile yourself? or do you need a packaged
version?
-Whit
2010/6/27 顾小波 :
> Hi,
>
> I post this message to the general r-help list hoping anyone within a wider
>
On 27.06.2010 17:48, Geoffrey Smith wrote:
Hello, I am trying to update the mgcv package on my Linux box and I keep
getting an "Out of memory!" error. Does anyone know of a fix for this?
Below is a snippet of the message that I keep getting: Thank you. Geoff
** R
** inst
** preparing package
Hi there,
I've written a script for reading 3D simulation data into R, rendering
it using RGL, and then saving the resulting plot using the
snapshot3d() function. The results are fantastic! However, whenever
RGL plots anything it automatically brings the viewing window into
focus. Since I
Hello, I am trying to update the mgcv package on my Linux box and I keep
getting an "Out of memory!" error. Does anyone know of a fix for this?
Below is a snippet of the message that I keep getting: Thank you. Geoff
** R
** inst
** preparing package for lazy loading
** help
*** installing help
Ravi,
Thank you very much for the pointer to parscale. This is extremely useful --
in this and some other problems that I am working on. Thanks again for the
valuable help.
> -Original Message-
> From: Ravi Varadhan [mailto:rvarad...@jhmi.edu]
> Sent: Saturday, June 26, 2010 11:52 PM
Hi Raoul,
I presume you need these summaries for a table of descriptive statistics for a
thesis/report/paper
("Table 1" as known informally by medical researchers). If this is the case,
then specify
method="reverse" to summary.formula. In the following small example, I create 4
groups of pat
On 06/26/2010 11:42 AM, G FANG wrote:
> Hi Martin,
>
> Thanks a lot for your advice.
>
> I tried the process you suggested as below, it worked, but in a
> different way that I planned.
>
> library(Biostrings)
> x <- c("ACTCCCGCCGTTCGCGCGCAGCATGATCCTG",
> "ACTCCCGCCGTTCGCGCGC",
I'd suggest using the functions within the Hmisc and plyr packages:
library(Hmisc); library(plyr)
df=data.frame(v1=rnorm(10), v2=rnorm(10),
wt=sample(1:5,rep=T),sex=rep(0:1,each=5)); df
ddply(df,~sex,summarise,v1.avg=wtd.mean(v1,wt),v2.avg=wtd.mean(v2,wt))
hope this helps, david freedman
--
Vi
I agree, i've seen procrustes in R, but not EDMA, R has natural
support for bootstrapping via the boot() library, i'm sure others
would be grateful if you wanted to write some functions..
CS
Corey Sparks
Assistant Professor
Department of Demography and Organization Studies
College of Public
the variable you want to analyze (first argument to tapply) and the
variable you want to analyze by (the factor, second arg to tapply)
both must have the same number of rows, that' s how I read this.
CS
Corey Sparks
Assistant Professor
Department of Demography and Organization Studies
College
You could try the remix function in remix package.
David
Le 27 juin 2010 à 06:48, RaoulD a écrit :
>
> Hi Christos,
>
> Thanks for this. I had a look at Summary.Forumla in the Hmisc
> package and it
> is extremely complicated for me. Still trying to decipher how I
> could use
> it.
>
> Regards,
I am using EDMA software and I have couple of papers about statistical shape
analysis and you are right about bootstrapping.
Wish R has an EDMA package and we could see how the results compatible with
EDMA software.
--
View this message in context:
http://r.789695.n4.nabble.com/Euclidean-Distan
Hi Corey,
Thanks so much for this. However, I get this error for tapply - "Error in
tapply(RT, RT$R, fun=WA):
arguments must have same length". Any idea how to get around this?
Thanks again,
Raoul
--
View this message in context:
http://r.789695.n4.nabble.com/Calculating-Summaries-for-each-
Hi Christos,
Thanks for this. I had a look at Summary.Forumla in the Hmisc package and it
is extremely complicated for me. Still trying to decipher how I could use
it.
Regards,
Raoul
--
View this message in context:
http://r.789695.n4.nabble.com/Calculating-Summaries-for-each-level-of-a-Catego
Hi Jim,
Thanks for the answer.
What I actually want is a session sequence 1,2,... per patient. This would
be very useful to look at trends of HPV infections from the first to the
second sample etc. It would also allow me to extract the HPV data of the
first sample (session 1).
Thx
JP
On Sat, Ju
28 matches
Mail list logo
