Dear R-Users,
I wish to simulate a binary outcome data set with
predictors (in the example below, age, sex and systolic BP). Is there a
way I can set the frequency of the outcome (y) to be say 5% (versus the
0.1% when using the seed below)?
# Example R-code based on Frank Harrell's De
Dear list,
I am analysing a set of quantitative proteomics data from 16 patients
which has a large numbers of missing data, thus some proteins are only
detected once, upto a maximum of 16.
I want to test each protein for normality by the Shapiro Wilk test
(function shapiro.test in package st
Tariq,
See inline for my reply.
Le mar. 15 juil. à 21:48, Tariq Perwez a écrit :
Hi Everyone,
I have a few fairly basic questions about upgrading and installing R
packages. First off, I am using Ubuntu Hardy Heron and have R 2.7.1
installed and working perfectly. I usually access R via Emacs
I don't know about TRICAST, but package actuar (on CRAN) provides some
more specifically actuarial functionality to R. You may want to have a
look. See also http://www.actuar-project.org,
Le lun. 14 juil. à 17:47, Kenneth Roy Cabrera Torres a écrit :
Hi R users:
I will like to know if some
Hi R-listers,
I would like to know how can i extract component no. when the RMSEP is
lowest?
Currently, I only plot it manually and then only feed the ncomp to the jack
knife command. However, I would like to automate
this step.
Please let me know. Many thanks.
Rgrds,
[[alternative HTM
Hi,
I needed a historical time series data on number of students are in
different subjects in their MS and Ph.D courses in US like how many students
took Statistics, how many are physics, nuclear physics etc, for at least
last 10 years. Can anyone give me some idea on how I can from where I can
Hi Everyone,
I have a few fairly basic questions about upgrading and installing R
packages. First off, I am using Ubuntu Hardy Heron and have R 2.7.1
installed and working perfectly. I usually access R via Emacs ESS interface
which I am still trying to get the hang of. My questions and issues are
Dylan Beaudette wrote:
Hi,
I am curious about how to interpret the table produced by
anova(ols(...)), from the Design package. I have a multiple linear
regression model, with some interaction, defined by:
ols(formula = log(ksat * 60 * 60) ~ log(sar) * pol(activity,
3) + log(conc) * pol(sand
Typo in the last one: (resend)
#GPS in Decimal Degrees in the form longitude latitude (raw data)
library(maptools)
# create a list of the coords
coordList <- list(
RM215 = matrix(c(-82.1461363, 33.5959109), nrow=1),
SC = matrix(c(-82.025888, 33.606454), nrow=1) ,
RM202 = matrix(c(-81.9906723
Here is what I would do:
#GPS in Decimal Degrees in the form longitude latitude (raw data)
library(maptools)
# create a list of the coords
coordList <- list(
RM215 = matrix(c(-82.1461363, 33.5959109), nrow=1),
SC = matrix(c(-82.025888, 33.606454), nrow=1) ,
RM202 = matrix(c(-81.9906723, 33.5
Actually,
http://www.stats.govt.nz/statistics-by-area/geography-mapping/download-digital-boundaries.htm
is probably better.
Ray
On Wed, 16 Jul 2008, Tom Love wrote:
> Can anyone point me to a map file for New Zealand Territorial Local
> Authorities? Apologies if this is obvious, but I'm rather
Hi the list,
I like the R logo (grey C and blue R) very much, specialy the drawing of
the letter with border and shadow. I would like to make something closed
with some other letters. Does anyone know how to get a similar result ?
Christophe
__
R-h
> -Original Message-
> From: [EMAIL PROTECTED]
> [mailto:[EMAIL PROTECTED] On Behalf Of Jim Lemon
> Sent: Tuesday, July 15, 2008 5:03 PM
> To: Rheannon
> Cc: r-help@r-project.org
> Subject: Re: [R] Row Sum, exclude positive values
>
> On Tue, 2008-07-15 at 14:35 -0700, Rheannon wrote:
> >
Did you find:
http://koordinates.com/find/?page=5
?
HTH
Ray Brownrigg
MSCS Victoria University
On Wed, 16 Jul 2008, Tom Love wrote:
> Can anyone point me to a map file for New Zealand Territorial Local
> Authorities? Apologies if this is obvious, but I'm rather new to
> mapping things, and after
On Tue, 2008-07-15 at 14:35 -0700, Rheannon wrote:
> Hello,
>
> I'd like to sum the values of a row from the first negative number (FN) to
> the last negative number (LN), but not add any positive values to the sum.
> Then apply this to each row of the data frame.
>
> For example if I have a data
Can anyone point me to a map file for New Zealand Territorial Local
Authorities? Apologies if this is obvious, but I'm rather new to
mapping things, and after an R search and a general Google search I
can't see anything which seems quite right. I'm hoping that there is
a publicly availabl
Case cohort function cch() is in survival package. In cch(), the prentice
method is implemented like this:
Prentice <- function(tenter, texit, cc, id, X, ntot,robust){
eps <- 0.0001
cens <- as.numeric(cc>0) # Censorship indicators
subcoh <- as.numeric(cc<2) # Subcohort indicators
Dear Rheannon,
Try
DF = c(4, 3, 2, 1, 0, -1, -2, -3, -2, 2, 1, -1, -2, -3, -2, -1, 1, 2)
sum(DF[DF<0])
[1] -17
HTH,
Jorge
On Tue, Jul 15, 2008 at 5:35 PM, Rheannon <[EMAIL PROTECTED]> wrote:
>
> Hello,
>
> I'd like to sum the values of a row from the first negative number (FN) to
> the last
Hello,
I'd like to sum the values of a row from the first negative number (FN) to
the last negative number (LN), but not add any positive values to the sum.
Then apply this to each row of the data frame.
For example if I have a dataframe with Row 1 values
DF = (4, 3, 2, 1, 0, -1, -2, -3, -2, 2,
On Tue, 2008-07-15 at 05:16 -0700, rcoder wrote:
> Hi everyone,
>
> I want to score a set of data (-ve to +ve) using a 0-10 scale. I have the
> data in an R matrix, so I need to add another column, containing the scores
> and resave.
>
Hi rcoder,
Maybe rescale (plotrix package) is what you want:
#GPS in Decimal Degrees in the form longitude latitude (raw data)
library(maptools)
RM215 <- matrix(c(-82.1461363, 33.5959109), nrow=1)
SC <- matrix(c(-82.025888, 33.606454), nrow=1)
RM202 <- matrix(c(-81.9906723, 33.5027653), nrow=1)
RM198 <- matrix(c(-81.926823, 33.4634678), nrow=1)
HC <- ma
On Tue, 2008-07-15 at 10:10 -0300, Leandro Marino wrote:
> Hi,
>
> I have an list() like this:
>
> $VAR1
> Num Perc media stdev min P5P10P25
> 1 4381 56.35 181.35 39.81 87.13 123.05 132.59 152.95
> 2 1628 20.94 192.83 43.76 87.13 125.09 138.78 162.04
> 3786 10.11
On Mon, 2008-07-14 at 14:40 -0700, Willa Wei wrote:
> Now, I want to have a
> data frame looks like shown below so that I can save it into my
> database:
>
> Level mean medianvar sdvalid.n
> 2 6.11 1.29 2885 53.72 8.3
On Tue, 2008-07-15 at 08:28 +1200, Rolf Turner wrote:
> ...
> Yeah, well I see that it works for you --- but it doesn't work for me!
> I.e. my original script doesn't work, but Peter D.'s modification
> does work.
>
> Dang! Why are ``they'' always picking on me? :-)
>
Hi Rolf,
I have had the sa
Thank you Ben! This is very clear.
rcoder
Ben Tupper wrote:
>
>
> On Jul 15, 2008, at 5:16 PM, rcoder wrote:
>
>>
>> Hi Ben,
>> Yes, this is more or less what I want to do. I want to apply this
>> data in
>> columns in a matrix, and insert the results to additional columns.
>> I am not
>>
Thanks very much to you both - it worked a treat!
Steve
_
100’s of Nikon cameras to be won with Live Search
__
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-hel
> Am
> I right in thinking that this *should* also remove the -99s (NA
> values)? Because at present, the lower end ot the file looks like this:
Judging from your output, the -99's haven't been converted to NA's -
you can fix this (and the 88s) by doing:
PopDens[PopDens == -99] <- NA
PopDens[PopD
Can you provide an example of what you have tried. This should work:
for(i in 1:4){
x <- try(yourFunction(...))
if (class(x) = "try-error") print('had a problem")
}
On Tue, Jul 15, 2008 at 6:59 AM, Anne-Marie Ternes <[EMAIL PROTECTED]> wrote:
> Dear helpers,
>
> I've got a main script, w
I am reasonably sure that it could be more efficient, but it would be
very helpfulto have some comments in the code and a description of
"what is the problem you are trying to solve". It looks like you can
setup some lists and process them more compactly.
On Tue, Jul 15, 2008 at 3:21 PM, stephen
tcltk (which is part of the standard distribution) if you want fine control;
or perhaps gWidgets will suffice. There are others (rJava, RGtk2, ...)
Also check the Cran website, as there is a GUI section there.
-- Bert Gunter
Genentech
-Original Message-
From: [EMAIL PROTECTED] [mailto:[E
Probably as the result of read.table without any headers, the column
names are "V1"..."V720". You need to add new column names. You have
statements:
colnames <- columnnames
rownames <- rnames
Are you assuming that these are assigning row/column names to the
structure? Try
colnames(PopDen) <-
Hello dead R-experts,
I work on x86_64-suse-linux and I am using R 2.7.1. I created several
scripts that will be used by several people that are not familiar with R. I
would like to create a GUI to call the scripts that the users would choose to
run, also, the GUI should allow them to choose
?factor
If all you want is the character value, then do:
as.character(sc[[1]]$Category[1])
On Tue, Jul 15, 2008 at 4:37 PM, <[EMAIL PROTECTED]> wrote:
> I have a command which returns a data fram if I am not mistaken:
>
> sc <- split(x, list(x$Category, x$SubCategory), drop=TRUE)
>
> Now I w
On Jul 15, 2008, at 5:16 PM, rcoder wrote:
Hi Ben,
Yes, this is more or less what I want to do. I want to apply this
data in
columns in a matrix, and insert the results to additional columns.
I am not
entirely aware of a good way of doing this.
e.g. take data from column B, apply normali
Hi Ben,
Yes, this is more or less what I want to do. I want to apply this data in
columns in a matrix, and insert the results to additional columns. I am not
entirely aware of a good way of doing this.
e.g. take data from column B, apply normalisation, and feed output into
column C
Thanks,
rcod
On 16/07/2008, at 7:40 AM, <[EMAIL PROTECTED]>
<[EMAIL PROTECTED]> wrote:
Thank you.
?for just gives me a + rompt indicating that I need to supply more
input. The same with ?while and ?repeat. Help(for) yelds:
help(for)
Error: unexpected ')' in "help(for)"
But thanks for the tip.
For some reason, cairoDevice has been crashing the Mac for a while. It has
something to do with the rotation of text through Pango. That's all I've
been able to determine. Kind of tough without access to a Mac... but it DID
work once upon a time..
2008/7/15 Felix Andrews <[EMAIL PROTECTED]>:
> De
I have a command which returns a data fram if I am not mistaken:
sc <- split(x, list(x$Category, x$SubCategory), drop=TRUE)
Now I wish to get the Category and SubCategory that the data was split on. So
my first attempt would be:
sc[[1]]$Category[1]
But that yields
[1] (Unknown)
46 Levels: (U
On Jul 15, 2008, at 8:16 AM, rcoder wrote:
Hi everyone,
I want to score a set of data (-ve to +ve) using a 0-10 scale. I
have the
data in an R matrix, so I need to add another column, containing
the scores
and resave.
Hi,
I am a little fuzzy on what you are asking, but my guess is th
Dear all,
I
have a grid of 720 columns by 360 rows of global population density
values, and hope to convert this to column format using the 'melt' command in
the 'reshape' package. I'm not receiving
any errors as such, but when the code has finished running, my output
looks like this:
> head(P
willemf wrote on 07/15/2008 08:42 AM:
> I am attempting to get publication quality graphs using R on Ubuntu. I
> encounter lots of problems in using cex to control font size: for instance
> cex=1.5 results in very blocky characters. I then tried to use res=1200
> while creating a PNG file, hoping t
Thank you both.
I managed to accomplish this tack with your help.
date = ts(time, start =1985, freq =4)
quarters = as.Date(time(date))
z = length(quarters)
win.graph()
par(mfrow=c(1,1),mex=0.7,bg="white")
matplot(1:n,corp.check,type="l",lty=1, col=2, ylab="$",xlab="",xaxt="n")
title(main="C
Thank you Jeff, I will follow up on this. I just cannot believe that R does
not have a good command of this. The obvious route is Postscript ourput,
since it is not raster-based and one can incorporate EPS files into
OpenOffice documents. However, when printing to a Postscript device, there
is no
I am just starting to use R language, and jumped into using svm (e1071) model
to do classification analysis using svm. Meanwhile, I used 10-fold cross
validation to evaluate initial classification accuracy. Now I am going to
run for example 100 times cross validation to determine the distribution
Thanks to everyone for the help and advice! It turns out that my problem was
using $HOME in the .First function in Rprofile.site. Since $HOME is a user
specific variable, it seems to have crashed when running from the
$R_HOME/etc/ directory. I added the other .Rprofile files without deletng
the Rpr
I'm coming from the AMOS world and am wondering if there is a simple
way to do multiple hypothesis testing in the manner of BIC analyses in
AMOS using the sem package in R. I've read the documentation, but
don't see anything in there except for basic BIC scores. Perhaps
someone has devised a simp
> -Original Message-
> From: [EMAIL PROTECTED]
> [mailto:[EMAIL PROTECTED] On Behalf Of
> [EMAIL PROTECTED]
> Sent: Tuesday, July 15, 2008 12:40 PM
> To: Erik Iverson
> Cc: [EMAIL PROTECTED]
> Subject: Re: [R] Iterations
>
> Thank you.
>
> ?for just gives me a + rompt indicating that I
Sorry, I'm in ESS.
Try ?Control
[EMAIL PROTECTED] wrote:
Thank you.
?for just gives me a + rompt indicating that I need to supply more input. The
same with ?while and ?repeat. Help(for) yelds:
> help(for)
Error: unexpected ')' in "help(for)"
But thanks for the tip.
Keivn
Erik Iverso
Hi wf
>> I just cannot believe that R does not have a good command of this.
Curious. I find R's graphical output matchless. Almost without exception I
use postscript and find the controls available under base graphics (?par) or
"lattice" adequate (to understate). Very occassionally I fiddle with
sorry this should work
On Tue, Jul 15, 2008 at 3:50 PM, stephen sefick <[EMAIL PROTECTED]> wrote:
RM215 <- matrix(c(-82.1461363, 33.5959109), nrow=1)
> RM215.sp <- SpatialPoints(RM215, proj4string=CRS("+proj=longlat
> +datum=WGS84"))
> d060101 <- as.POSIXct("2006-01-01", tz="EST")
> study_seq <- s
Try this:
format(down.215$time, "%H:%M:%S")
On Tue, Jul 15, 2008 at 4:50 PM, stephen sefick <[EMAIL PROTECTED]> wrote:
> RM215.sp <- SpatialPoints(RM215, proj4string=CRS("+proj=longlat
> +datum=WGS84"))
> d060101 <- as.POSIXct("2006-01-01", tz="EST")
> study_seq <- seq(from=d060101, length.out=76
R 2.7, WinXP
Hi, I am interested in estimating the spatial autoregressive lag model
y = rWy +Xb + e
where W is a square matrix of weights, r an autocorrelation parameter, b
a vector of coefficients, X a matrix of covariates.
There are several packages in R that can estimate this model (sna,
spde
RM215.sp <- SpatialPoints(RM215, proj4string=CRS("+proj=longlat
+datum=WGS84"))
d060101 <- as.POSIXct("2006-01-01", tz="EST")
study_seq <- seq(from=d060101, length.out=761, by="days")
up.215 <- sunriset(RM215.sp, study_seq, direction="sunrise",
POSIXct.out=TRUE)
down.215 <- sunriset(RM215.sp, study
Thank you.
?for just gives me a + rompt indicating that I need to supply more input. The
same with ?while and ?repeat. Help(for) yelds:
> help(for)
Error: unexpected ')' in "help(for)"
But thanks for the tip.
Keivn
Erik Iverson <[EMAIL PROTECTED]> wrote:
> If you read the help page, ?f
Sorry I missed the print part. When nothing was output I assumed that nothing
happened.
Thank you.
Kevin
Erik Iverson <[EMAIL PROTECTED]> wrote:
> If you read the help page, ?for, you might have seen under "Value", that
>
> 'for', 'while' and 'repeat' return the value of the last
>
# I am sure that I could be more efficient than this but how? Thanks in
advance.
#GPS in Decimal Degrees in the form longitude latitude
RM215 <- matrix(c(-82.1461363, 33.5959109), nrow=1)
SC <- matrix(c(-82.025888, 33.606454), nrow=1)
RM202 <- matrix(c(-81.9906723, 33.5027653), nrow=1)
RM198 <- m
Dear Friends,
INSEED announces following workshop this year.
"Statistical Models and Practices in Epidemiology (using R)" to be
organised jointly with the Department of Statistics, Manipal University,
Karnataka from 24-28 November, 2008. For details, see the
workshop website http://www.inseed.org
Dear Michael,
Does it work for you?
tear <- c(6.5, 6.2, 5.8, 6.5, 6.5, 6.9, 7.2, 6.9, 6.1, 6.3,
6.7, 6.6, 7.2, 7.1, 6.8, 7.1, 7.0, 7.2, 7.5, 7.6)
gloss <- c(9.5, 9.9, 9.6, 9.6, 9.2, 9.1, 10.0, 9.9, 9.5, 9.4,
9.1, 9.3, 8.3, 8.4, 8.5, 9.2, 8.8, 9.7, 10.1, 9.2)
opacity <- c(4.4,
Dear Friends,
INSEED announces following workshop this year.
"Bayesian statistics using OpenBUGS and R" to be organised at the
Department of Statistics, St. Thomas College, Pala, Kerala from 08-12
December, 2008. This is the second workshop of its kind.
For details, see the workshop website
http
Douglas Bates wrote:
On Tue, Jul 15, 2008 at 10:25 AM, Patrick Burns
<[EMAIL PROTECTED]> wrote:
That can be accomplished with 8 keystrokes.
A hint is to do the 4 keystrokes:
?lm
Umm - unless you are counting the implicit , that's only 3
keystrokes isn't it?
You give away that you're an Em
willemf wrote on 07/15/2008 08:42 AM:
I am attempting to get publication quality graphs using R on Ubuntu. I
encounter lots of problems in using cex to control font size: for instance
cex=1.5 results in very blocky characters. I then tried to use res=1200
while creating a PNG file, hoping that th
If you read the help page, ?for, you might have seen under "Value", that
'for', 'while' and 'repeat' return the value of the last
expression evaluated (or 'NULL' if none was), invisibly.
So if you want to see the values, print() them.
In general, from the first part of your message, i
Oops, typo- sorry, should be
for(i in 1:10)
{
print(i)
}
Mike
On Tue, Jul 15, 2008 at 1:39 PM, Michael Rennie <[EMAIL PROTECTED]> wrote:
> for(1 in 1:10)
> {
> print(i)
> }
>
> Mike
>
> On Tue, Jul 15, 2008 at 1:11 PM, <[EMAIL PROTECTED]> wrote:
>> I have a command th
library(maptools)
RM215 <- matrix(c(33.5959109, -82.1461363), nrow=1)
RM215.sp <- SpatialPoints(RM215, proj4string=CRS("+proj=longlat
+datum=WGS84"))
d060101 <- as.POSIXct("2006-01-01")
study_seq <- seq(from=d060101, length.out=761, by="days")
up <- sunriset(RM215, study_seq, direction="sunrise", P
for(1 in 1:10)
{
print(i)
}
Mike
On Tue, Jul 15, 2008 at 1:11 PM, <[EMAIL PROTECTED]> wrote:
> I have a command that reads in some data:
>
> x <- read.csv("Sales2007.dat", header=TRUE)
>
> Then I try to organize the data:
>
> sc <- split(x, list(x$Category, x$SubCategory), drop=TR
[EMAIL PROTECTED] wrote:
I have a command that reads in some data:
x <- read.csv("Sales2007.dat", header=TRUE)
Then I try to organize the data:
sc <- split(x, list(x$Category, x$SubCategory), drop=TRUE)
Then I want to iterate through the data. I was able to get the following to run
on the R
On Tue, Jul 15, 2008 at 10:25 AM, Patrick Burns
<[EMAIL PROTECTED]> wrote:
> That can be accomplished with 8 keystrokes.
> A hint is to do the 4 keystrokes:
> ?lm
Umm - unless you are counting the implicit , that's only 3
keystrokes isn't it?
> Angila Albaros wrote:
>>
>> Hello all,
>>
Is there a way to use a time zone independant in the sunriset function. We
have kept our instruments on eastern standard time. Any help would be
great!
On Tue, Jul 15, 2008 at 1:06 PM, Chuck Cleland <[EMAIL PROTECTED]>
wrote:
> On 7/15/2008 12:52 PM, stephen sefick wrote:
>
>> Does anyone know
Kevin,
By default, many functions only *return* a result, they don't explicitly
*print* it. There is no difference in interactive mode, but there is in
batch mode (e.g., in loops). Use print() or cat() for explicit printing
to console.
for(i in 1:100)
{
cat(i,"\n")
}
HTH,
Stephan
[EMA
Daren,
Not sure if it is any easier, but another solution is:
code <- unlist(strsplit("TCGACAATCGGTAACCCGTCT",""))
length(grep("[G]",code))
Steve
-Original Message-
From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]
On Behalf Of Daren Tan
Sent: Tuesday, July 15, 2008 11:28 AM
T
On Tue, 15 Jul 2008 07:08:24 -0700 (PDT)
A Ezhil <[EMAIL PROTECTED]> wrote:
> Dear All,
>
> I am trying to install R 2.7 on my openSUSE 10.3. I have faithfully followed
> instruction at http://cran.r-project.org/bin/linux/suse/ReadMe.txt. I have
> downloaded all the RPMs but still R complains
I have a command that reads in some data:
x <- read.csv("Sales2007.dat", header=TRUE)
Then I try to organize the data:
sc <- split(x, list(x$Category, x$SubCategory), drop=TRUE)
Then I want to iterate through the data. I was able to get the following to run
on the R console:
for(i in 1:length
On 7/15/2008 12:52 PM, stephen sefick wrote:
Does anyone know if there is a sunrise sunset calculator for R?
RSiteSearch("sunrise", restrict="function")
points to several related functions in the maptools package.
--
Chuck Cleland, Ph.D.
NDRI, Inc. (www.ndri.org)
71 West 23rd Street, 8th fl
I'm looking to analyze a large data set: a within-Ss 2*2*1500 design
with 20 Ss. However, aov() gives me an error, reproducible as follows:
id = factor(1:20)
a = factor(1:2)
b = factor(1:2)
d = factor(1:1500)
temp = expand.grid(id=id, a=a, b=b, d=d)
temp$y = rnorm(length(temp[, 1])) #generate s
Hi,
I didn't try automatic dependency resolution instead installed each library one
by one. It seems that tcl is installed and the libtcl8.4.so exists.
Below is the info from the system:
> rpm -q tcl
tcl-8.4.15-22
> whereis libtcl8.4.so
libtcl8.4: /usr/lib64/libtcl8.4.so
> rpm -i R-base-2.7.1-6.
Does anyone know if there is a sunrise sunset calculator for R?
--
Let's not spend our time and resources thinking about things that are so
little or so large that all they really do for us is puff us up and make us
feel like gods. We are mammals, and have not exhausted the annoying little
probl
are there any packages that calculate stream metabolism.
thanks
Stephen
--
Let's not spend our time and resources thinking about things that are so
little or so large that all they really do for us is puff us up and make us
feel like gods. We are mammals, and have not exhausted the annoying litt
Henrik,
As Wolfgang mentioned, the Biostrings package in Bioconductor has a
number of sequence manipulation functions. The alphabetFrequency
function would get you what you need.
> library(Biostrings)
> alphabetFrequency(DNAString("TCGACAATCGGTAACCCGTCT"))
A C G T M R W S Y K V H D B N - +
Hi,
And the Bioconductor package "Biostrings" is the place to go for any
serious work with sequences.
--
Best wishes
Wolfgang
--
Wolfgang Huber EBI/EMBL Cambridge UK http://www.ebi.ac.uk/huber
15/07/2008 16:43 Henrik Bengtsson
Hi Jon,
That only controls the print display of the matrix, not how one can
access the elements. I think my solution revolves around indexing in
as.matrix() with a mind to the fact that results will be duplicated
along the diagonal.
Cheers, and thanks all,
Mike
On Tue, Jul 15, 2008 at 11:43 AM,
The ecodist package has a convenience function full() that converts a
dist object to a symmetric matrix. After that subsetting works normally.
lower() performs the reverse operation.
Sarah
--
Sarah Goslee
http://www.functionaldiversity.org
__
R-help
Maybe
dmat<-dist(dat, method="euclidean",upper = TRUE,diag = TRUE)
can fix your problem with the triangular matrix?
Cheers
Jon
Michael Rennie wrote:
Not really,
I'd actually want
f[4:6,4:6]
to get comparisons of observations 4 to 6 only. And I'm still left
with the upper triangular matrix.
Seems like you can do:
library("matchprobes") # on Bioconductor
countbases("TCGACAATCGGTAACCCGTCT")[,"G"]
The catch is that it only counts A, C, G, and T:s and no other symbols.
/Henrik
On Tue, Jul 15, 2008 at 8:27 AM, Daren Tan <[EMAIL PROTECTED]> wrote:
>
> Any better solution than this
Daren Tan hotmail.com> writes:
> Any better solution than this ?
> sum(strsplit("TCGACAATCGGTAACCCGTCT", "")[[1]] == "G")
Try
table(strsplit("TCGACAATCGGTAACCCGTCT", ""))
A C G T
5 7 8 5
and get all 4 at once.
HTH
--
Ken Knoblauch
Inserm U846
Institut Cellule Souche et Cerveau
D
Any better solution than this ?
sum(strsplit("TCGACAATCGGTAACCCGTCT", "")[[1]] == "G")
_
[[alternative HTML version deleted]]
__
R-help@r-project.org mailing list
https://s
On 15 июл, 13:23, "hadley wickham" <[EMAIL PROTECTED]> wrote:
> An alternative to enscript is
> highlight,http://www.andre-simon.de/doku/highlight/en/highlight.html, which
> does
> come with R highlighting built in.
>
> Hadley
>
Thanks for pointing this out.
But I think I actually need enscript
That can be accomplished with 8 keystrokes.
A hint is to do the 4 keystrokes:
?lm
Patrick Burns
[EMAIL PROTECTED]
+44 (0)20 8525 0696
http://www.burns-stat.com
(home of S Poetry and "A Guide for the Unwilling S User")
Angila Albaros wrote:
Hello all,
I am new to r programmean
I am attempting to get publication quality graphs using R on Ubuntu. I
encounter lots of problems in using cex to control font size: for instance
cex=1.5 results in very blocky characters. I then tried to use res=1200
while creating a PNG file, hoping that this would solve the problem, but it
did
Hello all,
I am new to r programmeand need help. I want to do
multiple linear regression analysis. say, I have two matrix 'x' and 'y'. I
want, 'x' as my response variable and 'y' as predictor.
Each time one column of 'x' will be the response, say x[,1], then next x[,2]
and so on.
Hi there,
Does anyone know how to extract elements from the table returned by Manova()?
Using the univariate equivalent, Anova(), it's easy:
a.an<-Anova(lm(y~x1*x2))
a.an$F
This will return a vector of the F-values in order of the terms of the model.
However, a similar application using Manov
You are not selecting the headers (column names)of a dataframe. You seem to be
creating a new data.frame consisting of those names. It should give you a 1Xn
dataframe.
Is that what you intended to do?
What errors message do you get at V188?
--- On Mon, 7/14/08, Rheannon <[EMAIL PROTECTED]> wr
Still the same question:
Birgitle wrote:
>
> I try to use ?randomForest to find variables that are the most important
> to divide my dataset (continuous, categorical variables) in two given
> groups.
>
> But when I plot the outlier:
>
> plot(outlier(rfObject, cls=groupingVariable),
> type="p"
Hello everyone,
Is there any tools to build experimental designs for logistic models?
Thanks,
Jérémy Mazet
Département Génie des procédés
SOREDAB
La Tremblaye
78125 La Boissière Ecole
Tel : 01 34 94 37 09
[[alternative HTML version deleted]]
_
Dear Professor Kubovy
I do not have a Mac to test it on, but please try this:
library(cairoDevice)
Cairo()
grid::grid.newpage()
I expect that you will see a similar crash; if so, it would seem to be
a problem with your GTK+ libraries. I have heard that you need to have
Apple X11 installed (from M
Dear All,
I am trying to install R 2.7 on my openSUSE 10.3. I have faithfully followed
instruction at http://cran.r-project.org/bin/linux/suse/ReadMe.txt. I have
downloaded all the RPMs but still R complains about:
libtcl8.4.so is needed by R-base-2.7.1-6.1.i586
I searched for this library and
Better late than never, I suppose:
The second column is simply the first column divided by the variance of
the response that have been OOB up to that point (20 trees), times 100.
Best,
Andy
From: David Katz
>
> The verbose option gives a display like:
>
> > rf.500 <-
> + randomForest(new.x,
Not really,
I'd actually want
f[4:6,4:6]
to get comparisons of observations 4 to 6 only. And I'm still left
with the upper triangular matrix. This is a problem since I want to
sum the distances over the blocks that I am extracting.
Then again, I could just divide the sum by two and get the answ
Dear Leandro,
Another option could be sink(). See ?sink for more information. Here is an
example:
x = list(VAR1 = data.frame(x=rnorm(10), y=rnorm(10)),
VAR2 = data.frame(x=rnorm(10), y=rnorm(10)))
sink("C:/list1.txt")
x
sink()
HTH,
Jorge
On Tue, Jul 15, 2008 at 9:10 AM, Leandro Mari
On 15 July 2008 at 17:23, hadley wickham wrote:
| An alternative to enscript is highlight,
| http://www.andre-simon.de/doku/highlight/en/highlight.html, which does
| come with R highlighting built in.
Another alternative is GNU a2ps which has definitions for R source,
documentation and transcript
how about this
f <- as.matrix(dmat)
f[,4:6]
#you get repeats but I think this is what you want
On Tue, Jul 15, 2008 at 9:07 AM, Michael Rennie <[EMAIL PROTECTED]> wrote:
> Hi all,
>
> Does anyone have any tips for extracting chunks of data from a distance
> matrix?
>
> For instance, if one was in
1 - 100 of 132 matches
Mail list logo
