I have the following script, which gives me a prediction for each of
my observations (> 49k), and subsets my data frame by site (n = 183):
ts <- (by(dem16,dem16['Site'],function(dat)
try(predict(nls(Tw ~ mu + ((alpha - mu)/
(1 + exp(gamma*(B - Mean_air
Hi all
I have a question regarding the Fligner-Killeen test. I am using
- a PC with Windows XP (Build 20600.xpsp080413-2111 (Service Pack 3);
- the following R version:
> sessionInfo()
R version 2.7.0 (2008-04-22)
i386-pc-mingw32
I have a vector LENGTH and a factor RELATION that are distributed
Dear R gurus, particularly those of generous M$ tolerance and diverse
gifts and knowledge!
I have an interesting challenge that I will end up crunching in R
involving service usage by patients. Maybe I can do all of it in R but
I can't see how yet.
My situation is that our IT Department can
I also tried to compile things differently,
f95 -fno-second-underscore -c -fPIC pattern_dist.f90
gcc -std=gnu99 -shared -L/usr -o pattern_dist.so pattern_dist.o
now, I get the following error:
Error in dyn.load("~/myfortran/pattern_dist.so") :
unable to load shared library '/home/myfortran/pat
On Wed, 28 May 2008, Xiaohui Chen wrote:
step or stepAIC functions do the job. You can opt to use BIC by changing the
mulplication of penalty.
I think AIC and BIC are not only limited to compare two pre-defined models,
Indeed, the original Akaike papers were for a finite nested sequence of
binom.test(x=12, n=50, p=12/50, conf.level = 0.90)$estimate
Gundala Viswanath 写道:
With this line:
binom.test(x=12, n=50, p=12/50, conf.level = 0.90)
I get this output:
Exact binomial test
data: 12 and 50
number of successes = 12, number of trials = 50, p-value = 1
alte
With this line:
> binom.test(x=12, n=50, p=12/50, conf.level = 0.90)
I get this output:
> Exact binomial test
>
> data: 12 and 50
> number of successes = 12, number of trials = 50, p-value = 1
> alternative hypothesis: true probability of success is not equal to 0.24
> 90 percent confid
I would like to be able to extract the names of the variables in a formula that
specifies random effects. For example, given:
random = ~ 1+year | st_name
I'd like to be able to get "year" and "st_name" out of random. Neither
terms(random) nor random[2] seems to work. Is there a way to get vari
Hi all,
After running this code:
__BEGIN__
dat <- read.table("gene_prob.txt", sep = "\t")
n <- length(dat$V1)
print(n)
print(dat$V1)
__END__
With this input in "gene_prob.txt"
__INPUT__
HFE 0.00107517988586552
NF1 0.000744355305599206
PML 0.000661649160532628
TCF30.000661649160532628
NF2 0.
Sorry for the noise. ***After*** sending off my previous post,
I spotted the loony myself. The line
for(k=0; kThat's m for Mike not n for November. Sigh. Staring me in the face
all the time.
Again, apologies for the noise.
cheers,
Rolf
#
I've been trying to get my head around using matrices in calls to .C().
As an exercise I wrote some code to calculate the product of two
matrices.
(Well, it makes it easy to check if one is getting the right answer!)
After obtaining some advice from a Certain Very Wise Person at Oxford,
(to f
Sorry, in my previous email I forgot two commands for the prediction:
upperlogit <- predictionlogit$fit + 2*predictionlogit$se.fit
lowerlogit <- predictionlogit$fit - 2*predictionlogit$se.fit
I've included them in the email below again!
Dear Brian and list members,
Thanks very much for your
On 29/05/2008, at 1:48 PM, Gundala Viswanath wrote:
Hi,
Suppose I have the following tabular data:
1729_at | TRADD | TNFRSF1A-associated via death domain | protein-
coding
1773_at | FNTB | farnesyltransferase, CAAX box, beta | protein-coding
177_at | PLD1 | phospholipase D1, phosphatidylch
Using any 'significance level', I think is the main
problem in the stepwise variable selection method. As
such in 'normal' circumstances the interpretation of
p-value is topsy-turvy. Then you can only imagine as
to what happens to this p-value interpretation in this
process of variable selection...
Hi,
Suppose I have the following tabular data:
1729_at | TRADD | TNFRSF1A-associated via death domain | protein-coding
1773_at | FNTB | farnesyltransferase, CAAX box, beta | protein-coding
177_at | PLD1 | phospholipase D1, phosphatidylcholine-specific | protein-coding
What is the right separat
Dear Brian and list members,
Thanks very much for your response Brian!
I applied the adjusted calculation that you advised me to use
[1/(1+exp(-upperlogit))] and as a result I don't get any more NA values in my
upper confidence interval values.
Yet, some outcomes are very akward, since for ver
Hi Stephen,
Have you looked at 'save' and 'load'?
As far as I understand, to really release the memory
you need to close R, so you may try to write a script
(shell script on Unix, batch file on Windows) which
invokes Rcmd to load the data, make an iteration and
save the result, so that R dies bet
Andrew Robinson 写道:
On Wed, May 28, 2008 at 03:47:49PM -0700, Xiaohui Chen wrote:
Frank E Harrell Jr ??:
Xiaohui Chen wrote:
step or stepAIC functions do the job. You can opt to use BIC by
changing the mulplication of penalty.
I think AIC and BIC are not only limited to co
Try gantt.chart in the plotrix package.
On Wed, May 28, 2008 at 1:54 PM, kljosc <[EMAIL PROTECTED]> wrote:
>
> Dear R Community,
>
> I have a dataframe like this
>
> dat product1 product2 ... productn
> 01.1.2008 1 1 1
> 02.1.2008 1 1 2
>
On Wed, May 28, 2008 at 03:47:49PM -0700, Xiaohui Chen wrote:
> Frank E Harrell Jr ??:
> >Xiaohui Chen wrote:
> >>step or stepAIC functions do the job. You can opt to use BIC by
> >>changing the mulplication of penalty.
> >>
> >>I think AIC and BIC are not only limited to compare two pre-defin
[EMAIL PROTECTED] wrote:
Hi everyone,
I run the R loops on window XP and vista. Both are Intel core 2 Duo
2.2 GHz with 2 GB ram and XP is significantly faster than vista. Dose
anyone know how speed up R loops in vista?
Thank you in advance.
Chunhao Tu
Frank E Harrell Jr 写道:
Xiaohui Chen wrote:
step or stepAIC functions do the job. You can opt to use BIC by
changing the mulplication of penalty.
I think AIC and BIC are not only limited to compare two pre-defined
models, they can be used as model search criteria. You could
enumerate the info
Xiaohui Chen wrote:
step or stepAIC functions do the job. You can opt to use BIC by changing
the mulplication of penalty.
I think AIC and BIC are not only limited to compare two pre-defined
models, they can be used as model search criteria. You could enumerate
the information criteria for all
Hi,
I am reading the source code of rpart. I have problems understand the following
code and would appreciate for any helps. In rpart.s, there is a line:
rpfit <- .C(C_s_to_rp,
n = as.integer(nobs),
nvarx =
as.integer(nvar),
ncat =
as.integer(cats* !isord),
step or stepAIC functions do the job. You can opt to use BIC by changing
the mulplication of penalty.
I think AIC and BIC are not only limited to compare two pre-defined
models, they can be used as model search criteria. You could enumerate
the information criteria for all possible models if t
On 5/28/08, [EMAIL PROTECTED] <[EMAIL PROTECTED]> wrote:
> Hi,
> I'm trying to produce a plot of an image of a Matrix, but I don't get
> other colors than the default grey scale:
>
> > image(Matrix(topo.matrix.2),col.regions=topo.colors(100),colorkey=FALSE)
>
> this still is plotted in grey.
>
Hi all,
I have bootstrapped my weighted regression equation using the
following formula and the package boot to obtain bootstrap confidence
intervls for my parameters:
>drought <- read.table("D:/drought080525.txt", header=T)
>regres <- function(x, indices) {
>x <- x[indices,]
>coef(lm(x$AGB ~ x$
On Wed, May 28, 2008 at 04:15:34PM -0500, Ben Fairbank wrote:
>
> I would like to use plot() to plot two cumulative distribution curves so
> that a user of the plot can compare the distributions of the two
> variables. The following code draws two distributions separately, but I
> cannot find the
On Wed, May 28, 2008 at 6:18 AM, epigone26 <[EMAIL PROTECTED]> wrote:
> Hi,
> I wish to extract a subset of the information of given by
> summary(lmer.object) as a dataframe. In particular, I wish to extract
> just a table listing the Estimate, Std Error, and t-values rounded to
> 3 decimal places
Thanks -- that's very helpful! -Don
On Wed, May 28, 2008 at 4:34 PM, John Fox <[EMAIL PROTECTED]> wrote:
> Dear Donald,
>
> I can't guarantee that there aren't other problems, but your call to
> update() is in error; you need
>
> allmis <- update(allmis, white = recode(RACE, '1=1; else=0; '))
>
>
Greetings helpRs --
I would like to use plot() to plot two cumulative distribution curves so
that a user of the plot can compare the distributions of the two
variables. The following code draws two distributions separately, but I
cannot find the instruction necessary to add a second cumulative
Hi,
I'm trying to produce a plot of an image of a Matrix, but I don't get
other colors than the default grey scale:
> image(Matrix(topo.matrix.2),col.regions=topo.colors(100),colorkey=FALSE)
this still is plotted in grey.
Is there any mistake in my syntax?
Thanks and regards,
Javier
--
___
There is a very good book called "Data Manipulation with R" by Phil
Spector that just became available. It is brief and concise. I would
recommend that book for learning about manipulating data in tables.
For anyone interested in data exploration and graphics I would also
recommend Deepayan Sarka
Hi, I've seen in the NestCohort package that one can do a hazard model with a
binary outcome using covariates. I am interested in multistate hazard models
with time-varying covariates, but can't seem to find this already implemented
in an R package. Is this included somewhere but called something
Dear R Community,
I have a dataframe like this
dat product1 product2 ... productn
01.1.2008 1 1 1
02.1.2008 1 1 2
.
15.2.2008 2 2 NA
.
04.4.2008 2 2 1
05.4.2008 NA 2
Dear Donald,
I can't guarantee that there aren't other problems, but your call to
update() is in error; you need
allmis <- update(allmis, white = recode(RACE, '1=1; else=0; '))
not
allmis <- update(allmis, white <- recode(RACE, '1=1; else=0; '))
[The last ; in the recode specification is unne
Hi I am still fairly new to R but picking it up quickly. I have some
problems manipulating data in tables. I was wondering if anyone new any good
resources such as an R manual. Some of the intro pdfs I viewed do not show
how...much appreciated.
[[alternative HTML version deleted]]
___
Is there a way to write and analysis to disk and then reconstruct the whole
thing back into an object.
wavCWT() #wmtsa package
I am running out of memory on my computer and I was wondering if there was a
way to iterate through this process (as it is an iterative process anyway-
it just stores the
Hello,
I would like to display a heatmap with dendrograms and allow the user to click
on either dendrogram to choose a sub-dendrogram.
The function heatmap() uses layout() and image() and the plot method of
dendrogram to plot the heatmap and dendrograms, but if locator() is then called
and the us
see
?findIntervals
francogrex wrote:
Hi, this is probably quite simple but I can't seem to do it correctly. I have
a data frame of counts of infections in different ages; something like:
count=c(1, 1, 1, 2, 2, 2, 3, 3, 3, 3, 4, 4, 4, 4, 4, 7, 8, 8, 9, 9,
10, 11, 15, 17, 17, 17, 17, 19, 19, 19,
Dear all
I wish to carry out sigma- and beta-convergence analysis in respect of panel
data [wherein current value of one of the variables needs be regressed upon
suitably transformed lagged values of another variable(s)]. I am quite new to
the R-language and am not very much aware of the avail
Hi folks,
I have five imputed data sets and would like to apply the same
recoding routines to each. I could do this sort of thing pretty
easily in Stata using MIM, but I've decided to go cold turkey on other
stats packages as a incentive for learning more about R. Most of the
recoding is for nom
I did have the problem of not having two continuous variables and this
approach circumvents this, allowing me in fact to plot the rownames.
Prof Brian Ripley wrote:
>
> On Tue, 27 May 2008, T.D.Rudolph wrote:
>
>>
>> In the following example:
>> x <- rnorm(1:100)
>> y <- seq(from=-2.5, to=3.
Bill Shipley usherbrooke.ca> writes:
>
> Hello. I know how to make a bar plot in which a numeric y variable is
> plotted against some grouping variable X (say, groups A, B, C) when this
> grouping variable is subdivided into each of two subgroups; so the bars
> would be: (group A subgroup 1) bes
Hello,
I'm trying to save a graph as a .ps file to include it in a LaTex
presentation, but R replies:
Error: Invalid font type
In addition: Warning messages:
1: font family not found in PostScript font database
2: font family not found in PostScript font database
If I load the package grDevice
Dear Brian,
Thanks for the explanation -- it makes sense of what I've observed in a
range of problems. I think that the bottom line is that in typical problems
involving lists, pre-allocation of the pointers won't make much
(proportional) difference to the total time.
For curiosity, I modified th
Smita Pakhale wrote:
Hi Maria,
But why do you want to use forwards or backwards
methods? These all are 'backward' methods of modeling.
Try using AIC or BIC. BIC is much better than AIC.
And, you do not have to believe me or any one else on
this.
How does that help? BIC gives too much penaliz
Dear R Community,
I am trying to create an heatmap for the following set of data:
##example of data matrix
o4
V1 V2 V3 V4 V5 V6 V7 V8 V9 V10 V11 V12 V13 V14 V15 V16 V17 V18
green 27 28 29 29 28 28 26 25 25 23 23 22 22 21 21 22 22 22
yellow 6 8 8 7 7 7 6 6 6 7 7 7
Lars Fischer sec.informatik.tu-darmstadt.de> writes:
> Hello,
>
> well, I searched list-archive, cran and the references, but found
> nothing. Thus:
>
> Does anybody around here know anything about Dempster-Shafer Theory,
> Evidence Theory or Hints in R? Has anybody stumbled about a package tha
See ?is.holiday in chron. You need to supply
a .Holidays vector and then do this:
library(chron)
d1 <- Sys.Date()
d2 <- Sys.Date() + 100
sq <- sq(d1, d2, by = "day")
sum(!is.holiday(sq) & !is.weekend(sq)) # endpoints included
The fCalendar package also has functionality in this area.
On Wed, M
See ?offset
On Wed, 28 May 2008, Marie-Pierre Sylvestre wrote:
Dear R users,
I want to estimate a Cox PH model with time-dependent covariates so I am
using a counting process format with the following formula:
Surv(data$start, data$stop, data$event.time) ~ cluster(data$id) + G1 + G2 +
G3
Try this:
# Without the weekend
sum(!format(seq(T1a, T2a, by = "days"), "%w") %in% c("0","6"))
On Wed, May 28, 2008 at 10:30 AM, Thorsten Muehge <[EMAIL PROTECTED]> wrote:
> Hello R Freaks,
> I calculate the difference in days between two events with the following
> litte R expresseion:
>
> T1a
> "DE" == Dirk Eddelbuettel <[EMAIL PROTECTED]>
> on Wed, 28 May 2008 12:46:50 + writes:
DE> On Wed, May 28, 2008 at 02:29:10PM +0200, Martin
DE> Maechler wrote:
>> > "EH" == Erin Hodgess <[EMAIL PROTECTED]>
>> > on Sun, 25 May 2008 13:27:04 -0500 writes:
At 10:25 AM 5/28/2008, Esmail Bonakdarian wrote:
Erin Hodgess wrote:
I remember reading the colSum and colMean were better, when you need
sums and means
Well .. I'm waiting for the experts to jump in and give us the
straight story on this :-)
All of the algorithms are represented internally
Hello. I know how to make a bar plot in which a numeric y variable is
plotted against some grouping variable X (say, groups A, B, C) when this
grouping variable is subdivided into each of two subgroups; so the bars
would be: (group A subgroup 1) beside (group A subgroup 2), then (group B
subgroup 1
Hello R Freaks,
I calculate the difference in days between two events with the following
litte R expresseion:
T1a <- strptime(T1,"%m/%d/%y %H:%M:%S");
T2a <- strptime(T2,"%m/%d/%y %H:%M:%S");
T1b <- as.Date(T1a);
T2b <- as.Date(T2a);
days <- T2b-T1b;
time <- T2a - T1a;
In the project I would lik
> -Original Message-
> From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf
> Of Philip Twumasi-Ankrah
> Sent: Wednesday, May 28, 2008 6:52 AM
> To: [EMAIL PROTECTED]
> Cc: r-help@r-project.org
> Subject: Re: [R] "rbinom" : Does randomness preclude precision?
>
> Teds reply is a bit
-BEGIN PGP SIGNED MESSAGE-
Hash: SHA1
Gundala Viswanath wrote:
| Dear Ben,
|
| Given a set of words
| ('foo', 'bar', 'bar', 'bar', "quux" . "foo") this can be in 10.000
items.
| I would like to compute the significance of the word occurrence with
P-Value.
|
| Is there a simple way t
Hi there,
I would like to know if it is possible to modify a text file with a R function.
In fact I would like to know if a function "Search & Replace" exists.
My problem is to create config files from a Base file in which I have to modify
values of parameters.
My Base File:
#...
#...
Param1
yale.edu> writes:
>
> I am trying to use R lm() with quantitative and qualitative predictors, but am
> getting different results than those that I get in SAS.
>
> In the R ANOVA table documentation I see that "Type-II tests corresponds to
> the
> tests produced by SAS for analysis-of-variance
Hello -
Chip Barnaby wrote:
Dear all --
I want to compute weighted.mean() for grouped rows.
Data frame extract is just below. For each Key, I want the mean of IAC
weighted by Wt.
DP0[1:20,]
Key
IACWt
2 C3-PD030020050.P
Hallo,
i tried writing a function to extract
all the odds ratio's from a ftable:
(+ p.adjust needs to build in)
So i tried the following:
ORCalcul <- function(m) {
or<-matrix(1:(length(m[,1])-1)*(length(m[1,])-1)*5,length(m[,1])-1,length(m[1,])-1)
for(i in 1:length(m[,1])-1) {
Dear R users,
I want to estimate a Cox PH model with time-dependent covariates so I am
using a counting process format with the following formula:
Surv(data$start, data$stop, data$event.time) ~ cluster(data$id) + G1 +
G2 + G3 + G4 + G5 +G6
Gs represent a B-spline basis functions so they s
Thanks, that worked!
Andrew Robinson-6 wrote:
>
> Jen,
>
> try
>
> na.action = na.exclude
>
> Andrew
>
>
> On Wed, May 28, 2008 9:26 pm, Jen_mp3 wrote:
>>
>> I am working on a project to find a model for the concentration of
>> dissolved
>> oxygen in the river clyde. Ive fitted a linear mi
I think I see the rub: You would like to see the distribution of a sample
be identical to the distribution from which it was sampled. But if it is
random then that can happen only in the long run, not on every sample. That
is why samples from a normal density are *not* themselves normal - they'r
Dear R-community,
I'm looking forward to analyse the results statistically
for a new medical diagnostic tool. The aim is to know whether a given
subject is different from the mean or distribution of a population of
controls for one continuous variable (a neuro-imaging results which
can be q
Hi Maria,
But why do you want to use forwards or backwards
methods? These all are 'backward' methods of modeling.
Try using AIC or BIC. BIC is much better than AIC.
And, you do not have to believe me or any one else on
this.
Just make a small data set with a few variables with
known relationship
What do you mean by "... *eventual* nature of the distribution?" If you
simulated 100 samples, would you expect to see 1.5 successes? Or 1? Or 2?
How many, in your thinking, is "eventual?"
Charles Annis, P.E.
[EMAIL PROTECTED]
phone: 561-352-9699
eFax: 614-455-3265
http://www.StatisticalEng
Philip Twumasi-Ankrah yahoo.com> writes:
>
> Teds reply is a bit comforting and as indicated in my post,
> I am resorting to
> using "sample" but as an academic
> issue, does randomness preclude precision?
>
> Randomness should be in the sequence of zeros and ones and
> how they are simulate
Dear Ben,
Given a set of words
('foo', 'bar', 'bar', 'bar', "quux" . "foo") this can be in 10.000 items.
I would like to compute the significance of the word occurrence with P-Value.
Is there a simple way to do it?
- GV
On Wed, May 28, 2008 at 11:46 PM, Ben Bolker <[EMAIL PROTECTED]> wrot
Possibly your calculation overflows: exp(upperlogit)/(1+exp(upperlogit))
could be replaced by 1/(1+exp(-upperlogit)), or even better by
plogis(upperlogit). This could happen via the Hauck-Donner effect: the
fitted probabilities are very near one and the standard errors are very
large.
As for
Edward Wijaya gmail.com> writes:
>
> Hi,
>
> Is there an R function or package that computes
> p-value?
>
> -GV
Many, but this is far too vague a question for us
to answer usefully. Perhaps if you tell us specifically what
you want to do we can help. (Please make sure to
read the posting
Dear all --
I want to compute weighted.mean() for grouped rows.
Data frame extract is just below. For each Key, I want the mean of
IAC weighted by Wt.
DP0[1:20,]
Key
IACWt
2 C3-PD030020050.PD030020050.3.12.3.0 0.765 0.85
Erin Hodgess wrote:
I remember reading the colSum and colMean were better, when you need
sums and means
Well .. I'm waiting for the experts to jump in and give us the
straight story on this :-)
__
R-help@r-project.org mailing list
https://stat.ethz.
Teds reply is a bit comforting and as indicated in my post, I am resorting to
using "sample" but as an academic issue, does randomness preclude precision?
Randomness should be in the sequence of zeros and ones and how they are
simulated at each iteration of the process but not in the eventual n
I remember reading the colSum and colMean were better, when you need
sums and means
On Wed, May 28, 2008 at 8:26 AM, Esmail Bonakdarian <[EMAIL PROTECTED]> wrote:
> Neil Shephard wrote:
>>
>> Loops are not massively efficient within R.
>>
>> Look into using the apply() family of functions
>> (eapp
Neil Shephard wrote:
Loops are not massively efficient within R.
Look into using the apply() family of functions
(eapply()/lapply()/mapply/rapply()/tapply()).
Didn't someone post not too long ago that apply is
internally represented as a for-loop? Or am I not
remembering this correctly?
The
On 28-May-08 12:53:26, Philip Twumasi-Ankrah wrote:
> I am trying to simulate a series of ones and zeros (1 or 0) and I am
> using "rbinom" but realizing that the number of successes expected is
> not accurate. Any advice out there.
>
> This is the example:
>
> N<-500
> status<-rbinom(N, 1, prob
You asked for each of 500 to be included with probability 0.15, not for
15% of 500. If you want the latter, use sample, e.g.
sample(c(rep(1,75), rep(0,425)))
And to see if your 77 is reasonable for binomial sampling:
binom.test(77, 500, 0.15)
Exact binomial test
data: 77 and 500
On Wed, 28 May 2008, John Fox wrote:
Dear Brian and Bill,
Here's an interesting contrasting example (taken from this month's Help Desk
column in R News, which Bill has already seen), first verifying the relative
timings for Brian's example:
system.time({
+ a <- vector("list", 10001)
+ fo
Do it again. What did you get this time? Then do it another time. Do you
see what is happening?
Charles Annis, P.E.
[EMAIL PROTECTED]
phone: 561-352-9699
eFax: 614-455-3265
http://www.StatisticalEngineering.com
-Original Message-
From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On
A google search for "logistic regression with stepwise forward in r"
returns the following post:
https://stat.ethz.ch/pipermail/r-help/2003-December/043645.html
Haris Skiadas
Department of Mathematics and Computer Science
Hanover College
On May 28, 2008, at 7:01 AM, Maria wrote:
Hello,
I am
I am trying to simulate a series of ones and zeros (1 or 0) and I am using
"rbinom" but realizing that the number of successes expected is not accurate.
Any advice out there.
This is the example:
N<-500
status<-rbinom(N, 1, prob = 0.15)
count<-sum(status)
15 percent of 500 should be 75 but wha
On Wed, May 28, 2008 at 02:29:10PM +0200, Martin Maechler wrote:
> > "EH" == Erin Hodgess <[EMAIL PROTECTED]>
> > on Sun, 25 May 2008 13:27:04 -0500 writes:
>
> EH> Try: ./configure --with-x=no
>
> well.. no! really don't.
Seconded.
At best this qualified for the 'then do
Kim,
Is is what you want?
tmp <- readLines(textConnection(
"TGCATACACCGACAACATCCTCGACGACTACACCTACTACG
CGCCTACACCAACGATGTCCTGGACGACTTCTGCTACTACG
CGCCTACACCAACGATGTCCTGGACGACTTCTGCTACTACG
CGCCTACACCAACGATGTCCTGGACGACTTCTGCTACTACG
CGCCTACACCAACGATGTCCTGGACGACTTCTGCTACTACG
AGCATACACCGACAACATCCTCGATG
Dear Chunhao Tu,
There is, coincidentally, a discussion of loops and related issues in the
Help Desk column in the current issue of R News (see the newsletter link on
CRAN).
Regards,
John
--
John Fox, Professor
Department of Sociology
McMaster University
Hamilton, On
ctu wrote:
>
> Hi everyone,
> I run the R loops on window XP and vista. Both are Intel core 2 Duo
> 2.2 GHz with 2 GB ram and XP is significantly faster than vista. Dose
> anyone know how speed up R loops in vista?
>
>
Loops are not massively efficient within R.
Look into using the appl
> "EH" == Erin Hodgess <[EMAIL PROTECTED]>
> on Sun, 25 May 2008 13:27:04 -0500 writes:
EH> Try: ./configure --with-x=no
well.. no! really don't.
If you want to enjoy a Linux system and building from the
source, and then maybe learn how that is happening, learning
about she
Christoph,
I see two problems:
(1) use plot(x,y,pch=16,xlim=c(0,10),asp=1), as the default has the x/y scales
different.
(2) It looks to me that the expression "srt=180/pi*atan(slope)" should be
"srt=180*atan(slope)/pi"
Regards,
Tom
Dr. Christoph Scherber wrote:
Dear all,
I stumbled over
Dear Brian and Bill,
Here's an interesting contrasting example (taken from this month's Help Desk
column in R News, which Bill has already seen), first verifying the relative
timings for Brian's example:
> system.time({
+ a <- vector("list", 10001)
+ for(i in 0:1) a[[i+1]] <- i
+ })
Jen,
try
na.action = na.exclude
Andrew
On Wed, May 28, 2008 9:26 pm, Jen_mp3 wrote:
>
> I am working on a project to find a model for the concentration of
> dissolved
> oxygen in the river clyde. Ive fitted a linear mixed model as
> lme(DOW~Temperature+Salinity+Year+factor(Station)*factor(Dept
Ardia David <[EMAIL PROTECTED]> writes:
> Great, thanks a lot! It works properly now.
> By the way, how can I get rid of the warning message :
>
> * checking line endings in C/C++/Fortran sources/headers ... WARNING
> Found the following sources/headers with CR or CRLF line endings:
>
> Should I o
I am working on a project to find a model for the concentration of dissolved
oxygen in the river clyde. Ive fitted a linear mixed model as
lme(DOW~Temperature+Salinity+Year+factor(Station)*factor(Depth),
random~1|id), where id is an identifier of the day over 20 years defined as
Day*1 + Month*
Hello,
well, I searched list-archive, cran and the references, but found
nothing. Thus:
Does anybody around here know anything about Dempster-Shafer Theory,
Evidence Theory or Hints in R? Has anybody stumbled about a package that
I overlooked or implemented something in this area? I really would
Hi,
I wish to extract a subset of the information of given by
summary(lmer.object) as a dataframe. In particular, I wish to extract
just a table listing the Estimate, Std Error, and t-values rounded to
3 decimal places. I have learned how to extract the coefficients with
"round(fixef(lmer.object),
Hallo!
I found a question exactly as mine, but I did not found an answer. Therefore I
post this again - hopefully there will be an answer!
Thanks in advance!
karl
From: Berta
Date: Tue, 27 Feb 2007 18:58:48 +0100
Hi R-users,
I want to calculate the sample size needed to carry out a 2-sample
p
I feel the discussion about ease of installation on Linux (/*NIX type
systems) isn't really relevant to the Pros and Cons of R.
The problems encountered by people are often a consequence of their lack of
knowledge/understanding of the operating system, and not a deficiency of R
itself.
Just my t
Hello all,
I've come across an online posting
http://www.biostat.wustl.edu/archives/html/s-news/2001-10/msg00119.html
that described how to get confidence intervals for predicted values from
predict.glm. These instructions were meant for S-Plus. Yet, it generally seems
to work with R too, b
From the NEWS file for R-patched:
o A field containing just a sign is no longer regarded as numeric
(it was on all platforms in 2.7.0, but not on most in earlier
versions of R).
So the default behaviour has already been changed. The right way to
overcome this was (as you
Hello,
I am just about to install R and was wondering about a few things.
I have only worked in Matlab because I wanted to do a logistic
regression. However Matlab does not do logistic regression with
stepwiseforward method. Therefore I thought about testing R. So my
question is
can I do logi
1 - 100 of 114 matches
Mail list logo
