Re: [Rd] using Paraview "in-situ" with R?

ry helpful. The workflow, and mind flow, for the "in situ" mode makes you wonder how you ever did without it. I will probably need to update my R interface package and MJMDatascope is hardly ideal but improving both seems worth the effort. Thanks.  Mike Marchywka  44 Crosscreek Trail Jasper

Re: [Rd] using Paraview "in-situ" with R?

uch more useful on-the-fly than text or after the fact.  Mike Marchywka  44 Crosscreek Trail Jasper GA 30143 was 306 Charles Cox Drive  Canton, GA 30115 470-758-0799 404-788-1216  From: George Ostrouchov Sent: Wednesday, January 10, 2024 3:06 P

[Rd] using Paraview "in-situ" with R?

of anyone doing this interface or reasons its a boondoggle? Thanks.  Mike Marchywka  44 Crosscreek Trail Jasper GA 30143 was 306 Charles Cox Drive  Canton, GA 30115 470-758-0799 404-788-1216  __ R-devel@r-project.org mailing list https://stat.ethz.c

Re: [Rd] R packages to send plottable data to external apps

ackage you mentioned maybe one interface would be to emulate that action too as that was my original interest circa 2007 lol. fwiw. Thanks.  Mike Marchywka  44 Crosscreek Trail Jasper GA 30143 was 306 Charles Cox Drive  Canton, GA 30115 470-758-0799 40

[Rd] R packages to send plottable data to external apps

drop-in to the attached code and get something like the attached output that could also be switched to other data sources? This right now works via linux fifo and somewhat by UDP. It can queue data and stop making it if no one seems to be consuming it depending on the channel. Thanks.  Mike

Re: [Rd] Segfault in setMask in R 4.1

14 which I believe reconciles these two diverged sources, includes the GE v13 changes (see https://github.com/s-u/Cairo/) and fixes my segfual. I assume this will be pushed to CRAN at some point. Thank you very much Paul, Andre and Simon for you help! Mike On Tue, Sep 21, 2021, at 2:24 PM, Pa

Re: [Rd] Segfault in setMask in R 4.1

only release since 1.5-12 according to the NEWS file). The 1.5-13 tarball at https://www.rforge.net/Cairo/files/ contains no mention of strings like "setMask", "releasePattern" or "setPattern", which seem like they should be in there if that version has implemented

Re: [Rd] Segfault in setMask in R 4.1

wn code is presumably part of the problem. I would like to confirm that by failing to reproduce the bug in "vanilla" R 4.1 with a Cairo device. If anyone has any tips for how to do that (on Linux) or any other comments I would be very grateful. If our code is the problem then I'm st

[Rd] Segfault in setMask in R 4.1

I would be happy to give the output of any commands. If anyone has any suggestions then please let me know! Thanks! Mike Lee Williams __ R-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-devel

[Rd] unpackPkgZip: "unable to move temporary installation" due to antivirus

with increasing wait times, or using a custom unlink function. Happy to help out or test more on this issue. Also, if any R Core member could add me to R's Bugzilla members, that would be convenient for me. Cheers, Mike R version 3.3.3 (2017-03-06) -- "Another Canoe" Copyright (C) 2

Re: [Rd] Trouble installing Rcpp on AIX - missing "execinfo.h"

on-IBM softwares. I will subscribe to the rcpp-devel list, and probably buy the book. Mike Beddo -Original Message- From: Dirk Eddelbuettel [mailto:e...@debian.org] Sent: Friday, October 31, 2014 8:32 PM To: Mike Beddo Cc: r-devel@r-project.org Subject: Re: [Rd] Trouble installing Rcpp on

[Rd] Trouble installing Rcpp on AIX - missing "execinfo.h"

8 and got past that point, but now blocked by the absence of "execinfo.h" header file. Any ideas? Thanks, Mike __ R-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-devel

[Rd] AIX build R-3.1.1 Matrix package fails

ake[1]: Leaving directory `/home/meb/source/R-3.1.1/src/library/Recommended' make: *** [stamp-recommended] Error 2 - Mike __ R-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-devel

[Rd] Error: Line starting 'Package: tools ...' is malformed!

home/meb/source/R-3.1.1/src/library/tools' make[2]: *** [R] Error 1 make[2]: Leaving directory `/home/meb/source/R-3.1.1/src/library' make[1]: *** [R] Error 1 make[1]: Leaving directory `/home/meb/source/R-3.1.1/src' make: *** [R] Error 1 $

Re: [Rd] "make check" fails on lapack.R and stats-Ex.R

ficient for this case. Thanks also to Brian for sanity checking the linear algebra results in a previous post, and apologies for my imprecise terminology. Regards, Mike. -Original Message- From: Martyn Plummer [mailto:plumm...@iarc.fr] Sent: 23 October 2014 10:46 To: Pacey, Mike Cc: r-d

Re: [Rd] "make check" fails on lapack.R and stats-Ex.R

-0.3509 -0.2611 -0.50474 0.61606 -0.259216 > [4,] -0.2626 -0.3922 0.1044 -0.43748 -0.40834 0.638902 > [5,] -0.2204 -0.3946 0.3510 0.01612 -0.46428 -0.675827 > [6,] -0.1904 -0.3832 0.5111 0.53856 0.44664 0.257249 -Original Message- From: r-devel-boun...@r-project.org [

[Rd] "make check" fails on lapack.R and stats-Ex.R

--with-blas=-mkl=sequential --with-lapack=-mkl=sequential --disable-openmp --with-tcl-config=/usr/shared_apps/packages/tcl-8.5.12/lib/tclConfig.sh --with-tk-config=/usr/shared_apps/packages/tk-8.5.12/lib/tkConfig.sh Regards, Mike. - Dr Mike Pac

[Rd] AIX 7.1 and R build problems

Has anyone managed to build R-3.0.2 from source on AIX 7.1 using gcc 4.2.0. The configure script finishes with: ... checking whether wctrans exists and is declared... no checking whether iswblank exists and is declared... no checking whether wctype exists and is declared... no checking whether

Re: [Rd] R-3.0.1 - "transient" make check failure in splines-EX.r

y 2013 10:16:11 -0500 > Subject: RE: [Rd] R-3.0.1 - "transient" make check failure in splines-EX.r > > Thank you, Mike, I did not know that! > > I tried to prevent multi-threaded issues by setting the compiler options to > be single-threaded, but I know so little about thi

Re: [Rd] R-3.0.1 - "transient" make check failure in splines-EX.r

> From: avraham.ad...@guycarp.com > To: r-devel@r-project.org > Date: Thu, 30 May 2013 16:17:36 -0500 > Subject: Re: [Rd] R-3.0.1 - "transient" make check failure in splines-EX.r > > I just found this thread on StackOverflow >

Re: [Rd] [BioC] enabling reproducible research & R package management & install.package.version & BiocLite

I hate to ask what go this thread started but it sounds like someone was counting on  exact numeric reproducibility or was there a bug in a specific release? In actual  fact, the best way to determine reproducibility is run the code in a variety of packages. Alternatively, you can do everything

Re: [Rd] Passing R code from webpage

> Date: Mon, 18 Feb 2013 04:13:25 -0800 > From: matevzpav...@gmail.com > To: r-devel@r-project.org > Subject: Re: [Rd] Passing R code from webpage > > Yes, > y > knowledge). well, this getting off topic but I could suggest you go get cygwin and learn t

Re: [Rd] Passing R code from webpage

> Date: Mon, 18 Feb 2013 03:24:43 -0800 > From: matevzpav...@gmail.com > To: r-devel@r-project.org > Subject: Re: [Rd] Passing R code from webpage > > Hi, > > i think all of this i kinda complicated, even though in all the packages > authors are saying t

Re: [Rd] Passing R code from webpage

> Date: Sun, 17 Feb 2013 04:27:38 -0800 > From: mehrotra.pul...@gmail.com > To: matevzpav...@gmail.com > CC: r-devel@r-project.org > Subject: Re: [Rd] Passing R code from webpage > > hi , > > First of all you should as this question on r-help rather than

Re: [Rd] Passing R code from webpage

> From: simon.urba...@r-project.org > Date: Sun, 17 Feb 2013 09:16:57 -0500 > To: matevzpav...@gmail.com > CC: r-devel@r-project.org > Subject: Re: [Rd] Passing R code from webpage > > On Feb 16, 2013, at 6:48 PM, Matevz Pavlic wrote: > > > Hi all, > >

[Rd] Straight-quotes for usage and examples sections in PDF docs?

Is there any way to ensure that quotation marks are left as straight quotes and not converted to curly quotes in the \usage and \examples sections when the pdf versions of the docs are created? __ R-devel@r-project.org mailing list https://stat.ethz.ch/m

Re: [Rd] assistance building R on RHEL5

original makefile after the gcc packages were cleaned up. Rlapack_la_LIBADD = # $(FLIBS) $(LIBR) 'make check' just completed successfully so I'm hoping all is well. Thanks again. -mike On Thu, Nov 10, 2011 at 5:43 AM, Prof Brian Ripley wrote: > On Wed, 9 Nov 2011, Mike Da

[Rd] assistance building R on RHEL5

GCC_Fortran_compiler= if test "${GCC}" = yes; then case "${CC_VERSION}" in 3.*) GCC_Fortran_compiler=g77 ;; 4.*) GCC_Fortran_compiler=gcc44 ;; # <== updated to gcc44 esac fi thanks in advance - -mike __ R-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-devel

Re: [Rd] [R] any updates w.r.t. lapply, sapply, apply retaining classes

ability to handle higher level math, that this issue is making 'R' a less desirable language to use, as time progresses. I don't mean to claim that my opinion is the end-all-be-all, but I would like to hear others chime in, whether this is a large concern, or whether there is a ver

Re: [Rd] Randomness not due to seed

> Date: Tue, 19 Jul 2011 06:13:01 -0700 > From: jeroen.o...@stat.ucla.edu > To: r-devel@r-project.org > Subject: [Rd] Randomness not due to seed > > I am working on a reproducible computing platform for which I would like to > be able to _exactly_ rep

Re: [Rd] Controlling stdin and stdout in an embedded R instance

Thank you, this example helped. Mike Sonsini On 6/17/2011 10:29 AM, Simon Urbanek wrote: Mike, there are many examples of embedding R, one of them is rJava/JRI and you can see how to initialize R with custom callbacks at http://svn.rforge.net/org/trunk/rosuda/JRI/src/Rinit.c Cheers, Simon

Re: [Rd] arbitrary size data frame or other stcucts, curious about issues invovled.

> > Mike, > > this is all nice, but AFAICS the first part misses the point that there is no > 64-bit integer type in the API so there is simply no alternative at the > moment. You just said that you don't like it, but you failed to provide a > solution ... As for

Re: [Rd] arbitrary size data frame or other stcucts, curious about issues invovled.

ts, curious about issues > invovled. > From: jayemer...@gmail.com > To: marchy...@hotmail.com; r-devel@r-project.org > > Mike, > > > Neither bigmemory nor ff are "drop in" solutions -- though useful, > they are primarily for data storage and management and

[Rd] Controlling stdin and stdout in an embedded R instance

anyone on this list have experience or an example of communicating with an embedded R console using native R commands and consuming the output one command at a time in a "Unix-alike" environment? Thank you, Mike Sonsini __ R-devel@r-project.o

Re: [Rd] Detecting development environment

> From: had...@rice.edu > Date: Mon, 13 Jun 2011 09:21:07 -0500 > To: r-devel@r-project.org > Subject: [Rd] Detecting development environment > > Hi all, > > Is there a straight-forward, cross-platform way of determining if a > user has all the tools nee

[Rd] arbitrary size data frame or other stcucts, curious about issues invovled.

We keep getting questions on r-help about memory limits and I was curious to know what issues are involved in making common classes like dataframe work with disk and intelligent swapping? That is, sure you can always rely on OS for VM but in theory it should be possible to make a data structure

[Rd] manipulating the Date & Time classes

If others could chime in with any strange behaviors they've seen in working with times, maybe we could get a critical mass of issues that are worthy of an overhaul. Thanks & Regards, Mike &quo

Re: [Rd] Function works when custom defined but not when part of a package

Ah, "forgot" is a bit too generous. Seems I failed to get that far in the Extensions manual because I never dealt with S4 classes until now. Thanks for the pointer. Mike -- Mike Lawrence Graduate Student Department of Psychology Dalhousie University Looking to arrange a meeting? Check

[Rd] Function works when custom defined but not when part of a package

Hi folks, I'm not sure if this is a bug or not so I thought I'd check here first. I came across it while working on an update to my package where I try to get AICtab slot from the summary of an lmer object ( summary(my_lmer)@AICtab ). The attached contains a minimal example, where the code below

Re: [Rd] garbage collection & memory leaks in 'R', it seems...

Regards, Mike "Telescopes and bathyscaphes and sonar probes of Scottish lakes, Tacoma Narrows bridge collapse explained with abstract phase-space maps, Some x-ray slides, a music score, Minard's Napoleanic war: The most exciting frontier is charting what's already here

Re: [Rd] update.packages fails with directory not found

Bill, Thanks. The problem is common but not consistent on update. I'll wait a few days for packages to be updated at CRAN, then try it. Mike On Wed, 12 May 2010 08:49:42 -0700, "William Dunlap" wrote: > If you have the time and can consistently reproduce >this proble

Re: [Rd] update.packages fails with directory not found

Shortened a bit further. Answers to queries are at the end. MHP Duncan Murdoch wrote on 5/11/2010 7:03 PM: On 11/05/2010 6:21 PM, Mike Prager wrote: On Tue, 11 May 2010 11:05:45 -0400, Duncan Murdoch wrote: I'd appreciate it if you could check whether the problems remain in R-

Re: [Rd] update.packages fails with directory not found

On Tue, 11 May 2010 11:05:45 -0400, Duncan Murdoch wrote: >I'd appreciate it if you could check whether the problems remain in >R-devel, revision 51980 or later. (A build of this revision should be >on CRAN by tomorrow, at >http://cran.r-project.org/bin/windows/base/rdevel.html .) > Thanks fo

Re: [Rd] update.packages fails with directory not found

Bill, Not in my case. The Indexing Service is disabled on my PC. MHP William Dunlap wrote on 5/10/2010 10:42 AM: Someone once suggested this error happened was due to the Windows 'Indexing Service' (sp?) delaying the commital of a request to rename a directory (so a subsequent request to use

Re: [Rd] update.packages fails with directory not found

[New material at end] Duncan Murdoch wrote on 5/10/2010 9:33 AM: On 10/05/2010 8:28 AM, Mike Prager wrote: On Mon, 10 May 2010 06:33:54 -0400, Duncan Murdoch wrote: >Mike Prager wrote: >> Windows XP. I have just updated to R 2.11.0 and then run >> update.packages. In the se

Re: [Rd] update.packages fails with directory not found

On Mon, 10 May 2010 06:33:54 -0400, Duncan Murdoch wrote: >Mike Prager wrote: >> Windows XP. I have just updated to R 2.11.0 and then run >> update.packages. In the series of updates, a few will succeed, then I >> get a failure like >> >> >> package '

[Rd] update.packages fails with directory not found

ackage 'PBSmodelling' successfully unpacked and MD5 sums checked Error in normalizePath(path) : path[1]="c:\Program Files\R\Library/PBSmodelling": The system cannot find the file specified Indeed, the path is missing, though it was there when I issued the update.package

[Rd] unexpected behaviour of isSymmetric() (PR#14000)

Full_Name: Mike Danilov Version: 2.9.0 OS: Fedora Core 9 Submission from: (NULL) (142.103.121.198) When checking for the symmetry of a matrix, function isSymmetric.matrix() gets confused by the discrepancy of colnames/rownames if its argument. See the code snippet below. Perhaps it's a pr

[Rd] save() file size (PR#13816)

Full_Name: Mike Lawrence Version: 2.9.0 OS: OS 10.5.7 Submission from: (NULL) (208.98.203.100) When using save() I notice that sometimes saving smaller objects yield larger file sizes. x=data.frame( expand.grid( id=factor(1:1000) ,trial=1:24

Re: [Rd] gfortran optimization problems

such sometime errors are classic symptoms of access violations in Fortran, such as accessing a variable whose value has not been set, exceeding array bounds, or something similar. The usual suggestion is to recompile the Fortran with ALL error-checking options turned on and see if such a bug tu

Re: [Rd] savePlot() no longer automatically adds an extension to the filename.

the record. . . This change broke a *lot* of my code, including code used by others. Windows depends on file extensions. Fortunately, fixes using getRversion are not too difficult. -- Mike Prager, NOAA, Beaufort, NC * Opinions expressed are personal and not represented otherwise. * Any use

Re: [Rd] Request: Documentation of formulae

Martin Maechler <[EMAIL PROTECTED]> wrote: > Hi Mike, you make very worthy suggestions; but I assume the word > "request" is really putting off almost all of us "R corers". > You *have* heard that R is a volunteer project, that much of its > development ha

Re: [Rd] Request: Documentation of formulae

Mike Prager <[EMAIL PROTECTED]> wrote: > I was at a loss to understand the use of "/" until I looked in > "An Introduction [!] to R," where I found the explanation. > > My request is that more complete material on model formulae be > lifted from "

[Rd] Request: Documentation of formulae

ot;model formulae". Looking to print, neither the section on "model formula" on p.56 of MASS nor the section surrounding the above example explains the notation, nor could I find it in Dalgaard's book, nor in Maindonald and Braun. This seems too nice a feature to keep hidden in

[Rd] [rd] sage <--> r integration

good opportunity to build bridges between the two communities, and the lack of response (regardless of how GSoC issues play out) is a bit disappointing. --Mike __ R-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-devel

[Rd] Documentation: pls add xref from "sum" to "rowSums" (PR#11145)

Full_Name: Mike.Prager Version: 2.6.2 OS: Windows XP Prof + SP2 Submission from: (NULL) (192.154.40.252) Please add a cross-reference in R help files from "sum" to "rowSums" and also from "mean" to "rowMeans". Reasons: (1) New users may not be aware of rowSums, etc., and the simple functions wil

[Rd] How to tell R where to look for libgcc

LIBRARY_PATH to /lib, but that has no effect. Is there a way to force R to look in /lib for libgcc? -- Mike Waldron System Specialist RENCI at University of North Carolina – Chapel Hill CB #3455, ITS Manning, Rm 2509 Office: 919-962-9778 __ R-devel@r

Re: [Rd] stats package, optim and other optimization methods: more parameters?

eally changing the code, only adding some parameters to the interface), my experiments could be repeated by others. And if the official code is then changed again, I'd have to update the local code every time. Or is that unlikely? Or am I missing some important point here? Best, Mike

[Rd] stats package, optim and other optimization methods: more parameters?

g. for the line searches), just they are not accessible from the outside. Best wishes and many thanks, Mike Preuss __ R-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-devel

Re: [Rd] Aggregate factor names

Understood, but my point is that the naming I suggest should be the default. One should not be 'punished' for being explicit in calling aggregate. On 27-Sep-07, at 1:06 PM, Gabor Grothendieck wrote: > You can do this: > > aggregate(iris[-5], iris[5], mean) > > &g

[Rd] Aggregate factor names

another.iv ,yet.another.iv ) ,some.function ) ) -- Mike Lawrence Graduate Student, Department of Psychology, Dalhousie University Website: http://memetic.ca Public calendar: http://icalx.com/public/informavore/Public "The road to wisdom? Well, it's plai

Re: [Rd] SWF animation method

of gui file browsing at least, is significant. Mike On 8-Aug-07, at 12:20 PM, Kuhn, Max wrote: > Also, > > I've used ImageMagick's convert utility to make animated gifs. > Generate > a series of files (I used png) and then > > convert -delay 50 -page +0+0 im01.png

[Rd] SWF animation method

#x27;m a little too newb to do this myself I think). Mike -- Mike Lawrence Graduate Student, Department of Psychology, Dalhousie University Website: http://memetic.ca Public calendar: http://icalx.com/public/informavore/Public "The road to wisdom? Well, it's plain and simple to express:

Re: [Rd] Suggestion to extend aggregate() to return multiple and/or named values

,ifelse(i==1,'x',paste ('x',i,sep=''))) for(j in 1:num.cells){ temp[j,length(temp)]=FUN.out[[j]][i] } } return(temp) } On 13-Jul-07, at 1:29 PM, Mike Lawrence wrote: > Hi all, > > This

[Rd] Suggestion to extend aggregate() to return multiple and/or named values

agg(z,Ind,mean) #should be identical to aggregate aggregate(z,Ind,summary) #returns an error agg(z,Ind,summary) #returns named columns #Make a function that returns multiple unnamed values summary2=function(x){ s=summary(x) names(s)=NULL return(s) } agg(z,Ind,summary2) #returns

[Rd] R on an IBM Blue Gene/L (BGL)?

with cross compilation. I can post my entire config.log, but I figured I'd check first to see if anyone wanted to share their settings. Thanks for any help, Mike [[alternative HTML version deleted]] __ R-devel@r-project.org ma

Re: [Rd] Help with "row.names = as.integer(c(NA, 5))" in file from dput

want to ensure the widest possible compatibility for the way For2R is writing data in emulation of dput(). --Mike Peter Dalgaard <[EMAIL PROTECTED]> wrote: > Mike Prager wrote: > > I am trying to understand why syntax used by dput() to write > > rownames is valid (say, when re

[Rd] Help with "row.names = as.integer(c(NA, 5))" in file from dput

sn't work: > row.names(fred) <- as.integer(c(NA,5)) Error in `row.names<-.data.frame`(`*tmp*`, value = c(NA, 5)) : invalid 'row.names' length Is there any reason why the expression c(NA,5) is better here than the more natural 1:5 here? I will appreciate help

[Rd] Entry for "sub"

r the record, the major R reference books I have (Verani, V&R 4, Maindonald & Braun, S Prog) are rather thin on index entries under "character" or "string". I realize that if I already knew the answer, I could have found it, easily, but I didn't, and it was not easy. T

Re: [Rd] f2c to achieve reentrancy in odesolve?

everal members of the standards committee. I can't think of a better place to get advice on such a question. Mike -- Mike Prager, NOAA, Beaufort, NC * Opinions expressed are personal and not represented otherwise. * Any use of tradenames does not constitute a NOAA endorsement. __

[Rd] Problems Reading from Socket

I get lines that are split up by hexadecimal characters (e.g. element 13 -- 'a1'-- splits what should be one line: lines 12 + 14)? Am I misunderstanding what is needed to correctly read from a socket or is this a bug? Can anyone offer assistance? Thanks. -- Mike __ R-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-devel

Re: [Rd] Post CGI forms with built-in R function?

AGTCTGGACCTCGAGCC-- CCTCATCCTAACAGCTTGTCCTT---TTGGCTGCCTCTTT- CTTGTGTAGAA---CTTTCCATTGT--" [13] "a1" [14] "-TCTCCCTGGTGTCCAGAGTCATAGG---TAAGT- T-TCTGTC- TGTACAAAGTCTAATTTCCGGTCACTGTTGATTGTTTACTT

[Rd] Post CGI forms with built-in R function?

I wrote a package that requires downloading data from an external server based on parameters specified by the user. I have used RMySQL or Rcurl to accomplish this, but in the interest of simplicity for users of this package, I'd like this communication to not require installing other package

Re: [Rd] undefined type 'struct tms' when compiling for MinGW

Ok, that was it. After taking Msys out of the equation, and removing some extra folders at the start of my PATH that weren't supposed to be there, the whole thing compiled perfectly. Thanks again for your help. Mike Prof Brian Ripley wrote: > I think you are somehow running in MSYS (

Re: [Rd] undefined type 'struct tms' when compiling for MinGW

Prof Brian Ripley wrote: > On Mon, 24 Apr 2006, Mike Leahy wrote: > >> Hello list, >> >> Out of interest, I've been trying to compile R on WinXP with MinGW/MSYS. >> I've been following the instructions for compiling R on windows as >> closely as pos

[Rd] undefined type 'struct tms' when compiling for MinGW

7;d be happy to hear them... Mike. TCLTK_LIBS=/c/mingw/lib BLAS_LIBS=/c/mingw/lib LAPACK_LIBS=/c/mingw/lib ./configure --prefix=c:/mingw --with-lapack=yes --with-zlib=yes --with-system-pcre=yes --with-x=no --disable-nls --disable-rpath --enable-R-shlib ... make[3]: Entering directory `/src/R-2

Re: [Rd] Compiling PL/R against R.dll in Win32/MinGW

OK - I did try this with PostgreSQL 8.1.3 and got the same results. To use the CVS HEAD for PostgreSQL, I did have to make a couple changes to get it to compile, but it ends with the same results. Joe Conway wrote: > Mike Leahy wrote: >> Ok...well I've been hacking around with the

Re: [Rd] Compiling PL/R against R.dll in Win32/MinGW

undefined reference to `libpostgres_a_iname' nmth61.o(.idata$4+0x0): undefined reference to `_nm__pkglib_path' nmth64.o(.idata$4+0x0): undefined reference to `_nm__Dynamic_library_path' collect2: ld returned 1 exit status c:\MinGW\bin\dllwrap.exe: c:\MinGW\bin\gcc exited with

[Rd] Compiling PL/R against R.dll in Win32/MinGW

compile it such that it is shared? If that's not the case, than maybe someone on this list has a better understanding of the errors I'm getting (below). Thanks in advance for any suggestions. Mike gcc -O2 -Wall -Wmissing-prototypes -Wpointer-arith -Winline -Wdeclaration-after-statement

[Rd] (PR#8502) comment

In my example, I should have included the defaults to the wrapper function in its definition, rather than in the call to postscript(). That of course does NOT affect the validity of my bug report nor the ability of my example to demonstrate it. MHP

[Rd] Suboptimal EPS output (PR#8502)

Full_Name: Mike Prager Version: 2.2.1 OS: Windows XP with SP2 Submission from: (NULL) (205.156.36.17) When several EPS files are made with one invocation of postscript(), only the first displays correctly in gsview. Examination of the generated eps files with a diff utility reveals that

[Rd] Fixed plot height question

I've tried many things, so it's time to call on the gurus. I'm trying to make a plot that will conform to the width of the plot device but have a fixed height (say one inch regardless of the plot device height setting -- unless obviously it's less than the plot device). Is this possible?

Re: [Rd] a hack regarding "No documentation ...."

a newbie, I spend > most of my time searching/reading documentation. > > Any comments regarding the possible alternatives that I've > mentioned, or offers of your own alternatives, would be > appreciated, as would be suggestions or mini-outlines for > implementing the hack. &g

[Rd] a hack regarding "No documentation ...."

own alternatives, would be appreciated, as would be suggestions or mini-outlines for implementing the hack. TIA, Mike __ R-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-devel