[Charlie Strauss]
>>> level0: newly created objects
>>> level1: objects that survived 1 round of garbage collection
>>> level2: objects that survivied 2+ rounds of gargbage collection
>>>
>>> Since all of my numerous objects are level2 objects, and none of
>>> them are every deallocated, then I
On 1 Oct 2006 14:08:24 -0700, [EMAIL PROTECTED]
<[EMAIL PROTECTED]> wrote:
> I guess I'm just looking for a small code sample hooked up to the code
> I gave, that would collect the input, compare it to code such as:
>
> if x==5
> print "Five"
> elif x==6
> print "Six"
> elif x==7
> p
> What are the internal methods that I need to define on any class so that
> this code can work?
>
> c = C("three")
>
> i = int(c) # i is 3
>
> I can handle the part of mapping "three" to 3, but I don't know what
> internal method is called when int(c) happens.
>
> For string conversion, I just
>> Here, domain name doesn't contain subdomain, or should I
>> say, domain's part of 'www', mail, news and en should be
>> excluded.
>
> It's a little more complicated, you have to treat co.uk about
> the same way as .com, and similarly for some other countries
> but not all. For example, subd
<[EMAIL PROTECTED]> wrote in message
news:[EMAIL PROTECTED]
> Ted Zeng:
>> I store some test results into a database after I use python
>> To pickle them (say, misfiles=['file1','file2'])
>> Now I want to display the result on a web page which uses PHP.
>> How could the web page unpickle the resu
On 3 Oct 2006 10:50:04 -0700, [EMAIL PROTECTED]
<[EMAIL PROTECTED]> wrote:
> I found myself writing:
>
> for f in [i for i in datafiles if '.txt' in i]:
> print 'Processing datafile %s' % f
>
> but I was wishing that I could have instead written:
>
> for f in in datafiles if '.txt' in f:
>
> I'd also love to see string constants implemented some day too
> (like str.whitespace and str.ascii_letters).
You mean like the "string" module provides? :)
>>> import string
>>> print '\n'.join(["%s -> %s" % (s, repr(eval('string.%s' %
s))) for s in dir(string) if isinstance(eval('string.%s
> def f(var=1):
> return var*2
>
> What value do I have to pass to f() if I want it to evaluate var to 1?
> I know that f() will return 2, but what if I absolutely want to pass a
> value to f()? "None" doesn't seem to work..
>>> def f(var=1):
... return var*2
...
>>> f()
2
>>> f(0.5)
1.0
t (the address of which just
changed and I don't have it handy, but I'm sure you can find it).
For your particular issue, you might try tweaking pickle to convert
int64 objects to int objects. Assuming of course that you have enough of
these to matter, otherwise, I suggest just leaving things alone.
-tim
--
http://mail.python.org/mailman/listinfo/python-list
> I have been using the string.replace(from_string, to_string, len(string))
> to replace names in a file with their IP address.
> For example, I have definitions file, that looks something like:
> 10.1.3.4 LANDING_GEAR
> 20.11.222.4 ALTIMETER_100
> 172.18.50.138 SIB
> 172.18.50.138 LAPTOP
>
> I have a list like
>e = ['a', 'b', 'e']
> and another list like
>l = ['A', 'a', 'c', 'D', 'E']
> I would like to remove from l all the elements that appear in e
> case-insensitive. That is, the result would be
>r = ['c', 'D']
>
> What is a *nice* way of doing it?
Well, it's usuall
> That is a nice solution.
>
> But, how about modifying the list in place?
>
> That is, l would become ['c', 'D'].
>
>> >>> e = ['a', 'b', 'e']
>> >>> l = ['A', 'a', 'c', 'D', 'E']
>> >>> s = set(e)
>> >>> [x for x in l if x.lower() not in s]
>> ['c', 'D']
Well...changing the requirements m
> Yeah, I ended up doing a similar kind of loop. That is pretty messy.
>
> Is there any other way?
I've already provided 2 (or 3 depending on how one counts)
solutions, each of which solve an interpretation of your original
problem, neither of which involve more than 3 lines of fairly
clean co
> from sets import Set as set # Python 2.3
>
> b = list( set([i.upper() for i in b) - set([i.upper() for i in a] ) )
Just a caveat...this can change the order of items in the results
as sets (and their differences) are inherently unordered data
structures. If order of the items in the list n
ere is a standard "print" dialog for Windows that shows you the
familiar dialog, with the list of printers and all of the options. In
wxPython, I believe it is called wx.PrintDialog.
In Pywin32, win32print.EnumPrinters can give you the list of available
printers.
--
Tim Roberts, [EMAIL PROTECTED]
Providenza & Boekelheide, Inc.
--
http://mail.python.org/mailman/listinfo/python-list
[Michael B. Trausch]
>> Let's say that I want to work with the latitude 33.6907570. In Python,
>> that number > can not be stored exactly without the aid of
>> decimal.Decimal().
>>
>> >>> 33.6907570
>> 33.6907568
>> >>>
>>
>> As you can see, it loses accuracy after the 6th decimal place.
dn't check that they were actually right). Using some of
the other suggestions mentioned in this thread may make things better
still. It's possible that some intermediate chunk size might be better
than collecting everything into one string, I dunno.
cStringIO might be helpful here as a buf
undary conditions you apply.
The general idea is this:
result = ia[n-1:]
for i in range(n-1):
numpy.maximum(result, ia[i:-n+i], result)
This punts on dealing with the ends (and I haven't tested this version),
but should give you the idea.
-tim
--
http://mail.python.org/mailman/listinfo/python-list
[Matt Moriarity]
>> try surrounding your sum argument in brackets:
>>
>> sum([phi(x // ps[i+1], i) for i in range(a)])
>>
>> instead of:
>>
>> sum(phi(x // ps[i+1], i) for i in range(a))
[Michael Press]
> Thank you. That makes it work.
But is a wrong solution ;-) As others have suggested, it's a
| " c:\documents and settings\060577\Local Settings\Application
| Data\Microsoft\Outlook "
| where 060577 represents username. I want my script to
| identigy the user
| logged in and go to the resp outlook folder or should be able to read
| outlook store directory path from registry and the copy t
[... snip ...]
| ---
| how can i make the following code work, I have probelm with filepath
| declaration.
| ---
| import os, shutil
| filepath = ' C:\\Documents and Settings\\060577\\Local
| Settings\\
| >
| > import os, sys
| > from win32com.shell import shell, shellcon
| >
| > local_app_data = shell.SHGetSpecialFolderPath (0,
| > shellcon.CSIDL_LOCAL_APPDATA)
| > outlook_path = os.path.join (local_app_data, "Microsoft", "Outlook")
| >
| > print outlook_path
| >
| >
|
| The above code was fin
| I am sorry I am providing the code i used as it is. Being newbee to
| programming I have tinkerd with various options i found on the net.
Thanks. That makes it a lot easier
[... snip ...]
| source = outlook_path
| #source = outlook_path +'\\*'
| print source
[...]
| win32file.CopyFile (sourc
> line is am trying to match is
> 1959400|Q2BYK3|Q2BYK3_9GAMM Hypothetical outer membra29.90.00011 1
>
> regex i have written is
> re.compile
> (r'(\d+?)\|((P|O|Q)\w{5})\|\w{3,6}\_\w{3,5}\s+?.{25}\s{3}(\d+?\.\d)\s+?(\d\.\d+?)')
>
> I am trying to extract 0.0011 value from the above line
On 23 Nov 2006 03:13:10 -0800, Daniel Austria <[EMAIL PROTECTED]> wrote:
> Sorry,
>
> how can i convert a string like "10, 20, 30" to a list [10, 20, 30]
>
> what i can do is:
>
> s = "10, 20, 30"
> tmp = '[' + s + ']'
> l = eval(tmp)
>
> but in my opinion this is not a nice solution
>
Not nice, e
On 23/11/06, Steven D'Aprano <[EMAIL PROTECTED]> wrote:
> On Thu, 23 Nov 2006 03:13:10 -0800, Daniel Austria wrote:
>
> > Sorry,
> >
> > how can i convert a string like "10, 20, 30" to a list [10, 20, 30]
> >
> > what i can do is:
> >
> > s = "10, 20, 30"
> > tmp = '[' + s + ']'
> > l = eval(tmp)
>
On 23 Nov 2006 04:09:18 -0800, Vania <[EMAIL PROTECTED]> wrote:
> Hi, I'm not sure this is the proper forum but I try nevertheless.
> The problem I'am facing is that the socket library always fail to
> connect to an URL. The net effect is that I can not use setuptools.
> I'm using Python2.4 on a wi
On 23/11/06, Fredrik Lundh <[EMAIL PROTECTED]> wrote:
> Tim Williams wrote:
> >>>>
>
> and the use of a list comprehension is pretty silly to, given that you want
> to apply the same *function* to all items, and don't really need to look
> it up
ur at one time instant
Well, as long as we're being pedantic, surely that should read "only one
thing can occur at any time instant..."
--
Tim Roberts, [EMAIL PROTECTED]
Providenza & Boekelheide, Inc.
--
http://mail.python.org/mailman/listinfo/python-list
?
It has been my experience that virtually every use of the "is" operator
(except "is None") is wrong.
Now, I fully understand that there are perfectly valid uses for "is", and
the standard library contains a few, but for the non-guru casual Python
programmer, I
I'm not sure if this will /solve/ your problem, but it's
something I noticed...
> UnitList = open('/Python25/working/FacList.txt', 'r')
> RawData = open('/Python25/working/data.txt', 'r')
Here, you open RawData once...
> Output = open('/Python25/working/output.txt', 'a')
>
> def PullHourlyData
irth Defects; Toxic ChemicalsAntibiotics,
>AnimalsAgricultural Subsidies, Global TradeAgricultural
>SubsidiesBiodiversityCitizen ActivismCommunity...
What do you want out of this? It looks like there are several levels
crammed together here. At first blush, it looks like topics separat
t is wrong. Can somebody point me directions. I
really need the PIL to work.
Thx, Tim
--
http://mail.python.org/mailman/listinfo/python-list
Thx, I got it. I installed PIL through the automatic install tool.
Which resolved some dependencies.
Fredrik Lundh schrieb:
> Tim Adler wrote:
>
> > I'm quite new to Python. I'm working on a webproject with Django and
> > need to install the Python Imaging Library.
[EMAIL PROTECTED]
| When rightclicking a, for example, pdf file on windows, one normally
| gets a screen with three or four tags. Clicking on one of the summary
| tag one can get some info like "title", "Author", "category",
| "keyword"
| etc..
[warning: not my area of expertise]
That informat
[Dennis Lee Bieber]
| > When rightclicking a, for example, pdf file on windows, one normally
| > gets a screen with three or four tags. Clicking on one of
| the summary
| > tag one can get some info like "title", "Author",
| "category", "keyword"
| > etc..
| >
| Doesn't for me... Right-clicking
[EMAIL PROTECTED]
| When rightclicking a, for example, pdf file on windows, one normally
| gets a screen with three or four tags. Clicking on one of the summary
| tag one can get some info like "title", "Author", "category",
| "keyword"
| etc..
This (Delphi) article is about the most informativ
> I have a list of numbers and I want to build another list with every
> second element multiplied by -1.
>
> input = [1,2,3,4,5,6]
> wanted = [1,-2,3,-4,5,-6]
>
> I can implement it like this:
>
> input = range(3,12)
> wanted = []
> for (i,v) in enumerate(input):
> if i%2 == 0:
> wa
me idea that, for better or for
worse is considerably less verbose:
def continue_join_2(linesin):
getline = iter(linesin).next
while True:
buffer = getline().rstrip()
try:
while buffer.endswith('_'):
buffer = buffer[:-1] + getline().rstrip()
except StopIteration:
raise ValueError("last line is continued: %r" % line)
yield buffer
-tim
[SNIP]
--
http://mail.python.org/mailman/listinfo/python-list
>> I want to know what type is a variable.
>
> You should try to treat it as a list, catch the exceptions
> raise when it is a string (problably ValueError, TypeError ou
> Attribute error, depends on what are you doing), and then
> treat it as a string. This is the BAFP (better ask for
> forgivene
s like a compiled
program. py2exe is one example.
--
Tim Roberts, [EMAIL PROTECTED]
Providenza & Boekelheide, Inc.
--
http://mail.python.org/mailman/listinfo/python-list
[Aahz]
>>> Anyone else getting "Python-related" spam? So far, I've seen messages
>>> "from" Barry Warsaw and Skip Montanaro (although of course header
>>> analysis proves they didn't send it).
[Thomas Heller]
>> I'm getting spam not only from Barry, but also from myself ;-) with
>> forged headers
[EMAIL PROTECTED]
| Sorry if i did not make myself clear. let me try again.
|
| I can detect when the db is up and not responding, however,
| if the DB does not start at all, my local application hangs. I need
to find a
| way to determine if the DB has started, that's all.
Maybe (and only
nd the world, and much longer before
people actually download the message to their local reader, then an equal
amount of time for replies to get back to you.
--
Tim Roberts, [EMAIL PROTECTED]
Providenza & Boekelheide, Inc.
--
http://mail.python.org/mailman/listinfo/python-list
something that
will do most of the job, probably in PHP. Is your website already using
Python?
--
Tim Roberts, [EMAIL PROTECTED]
Providenza & Boekelheide, Inc.
--
http://mail.python.org/mailman/listinfo/python-list
> I am sure this is a basic math issue, but is there a better way to
> ensure an int variable is divisible by 4 than by doing the following;
>
> x = 111
> x = (x /4) * 4
>
> Just seems a bit clunky to me.
You're right...you'll want to read up on the "modulo" operator:
if x % 4 <> 0:
pri
"Lad" <[EMAIL PROTECTED]> wrote:
>
>Hello Tim,
>Thank you for your reply.
>Yes, my site uses Python.
>Do you have any idea how to add video playing ( video streaming
>feature)to my webiste?
That's not the hard part. You can use an or tag to play a
movie
age. Then you can use your Python web site
to create the appropriate HTML.
--
Tim Roberts, [EMAIL PROTECTED]
Providenza & Boekelheide, Inc.
--
http://mail.python.org/mailman/listinfo/python-list
[Moqtar]
| I am trying to walk a directory and print the file and its modified
| time. When the path is longer then 259 characters i get an error
| "Filename too long". I guess these is because windows limitation on
| path length.
|
| My code:
|
[... snip code ...]
|
| Traceback (most recent
> def foobar(arg1, arg2, arg3):
> def helper(arg):
> do something with arg1 and argument
> def foo():
> do something with arg1 and arg3 and
> call helper
> def bar():
> do something with arg1 and arg2
> def zoo(
[kai rosenthal]
| with ls -l on windows I get
| -rw-r--r-- 1 500 everyone 320 Nov 09 09:35 myfile
|
| How can I get on windows with a standard python 2.2 (without windows
| extensions) the information "500" and "everyone" (owner and group)?
| Also I cannot use popen('ls -l').
Wow. Python 2.2. No
[Fredrik Lundh]
| Tim Golden wrote:
|
| > Wow. Python 2.2. No extensions. Not even popen (). You don't
| > want much, do you? I *think* the answer is that you can't.
|
| does the "group" concept even exist on Windows ? cannot recall I've
| ever seen "
>> with ls -l on windows I get
>> -rw-r--r-- 1 500 everyone 320 Nov 09 09:35 myfile
>
> Are you by any chance running cygwin? That comes with ls, but
> windows doesn't.
Another alternative might be mounting their Windows-formatted
drive from within a *nix-like OS. These permissions are usually
[Duncan Booth]
| You can get the owner by doing os.popen('dir /q') and parsing
| the output, but it is a string not a number (which I guess is why
| stat/lstat can't return a value).
Good one; I'd forgotten about that. However, I don't know
if the OP's restriction against popen ("ls- l") exten
>> Is there an easy (i.e.: no regex) way to do get the names of all
>> parameters?
>>
>> get_parameters(template) should return ["name", "action"]
>
> How about:
>
> class gpHelper:
> def __init__(self):
> self.names = set()
> def __getitem__(self, name):
> self.names.add(n
ust passes it to sendmail.
Ummm, I'm rather confused as to why you don't just have sendmail do this.
After all, that is its primary function: to run as a daemon, listening on
port 25, and delivering incoming messages to local mailboxes.
--
Tim Roberts, [EMAIL PROTECTED]
Providenza & B
> I'd like to see this regex. And make sure it works correctly with this
> format string:
>
> """%(key)s
> %%(this is not a key)d
> %%%(but this is)f
> %%%(%(and so is this)%()%%)u
> and don't forget the empty case %()c
> but not %%()E
> and remember to handle %(new
> lines)X correctly
>
>> - because error messages are not debugging tools (better use unit
>
> Then what are they? Machine-generated poetry?
>>> me.__cmp__(gruntbuggly['freddled'].micturations,
bee[LURGID].gabbleblotchits[PLURDLED]) == 0
Traceback (most recent call last):
File "", line 1, in ?
VogonPoetryExcepti
> How do you compare Python to Lisp? What specific advantages do you
> think that one has over the other?
Easy...
Python reads like pseudocode
Lisp reads like line-noise (much like most Perl or Ruby code)
Python makes better use of my time as a programmer because it
maps fairly closely to how
[EMAIL PROTECTED]
| I've got a database of information that is encoded in Windows/CP1252.
| What I want to do is dump this to a UTF-8 encoded text file (a RSS
| feed).
| "UnicodeDecodeError: 'ascii' codec can't decode byte 0x92 in position
| 163: ordinal not in range(128)"
|
| So somewhere I'm m
> I'm semi-seriously wondering if snake jokes are valid in the Python
> community since technically, Python came from Monty Python, not
> slithery animals.
>
> Problem is I don't know that anyone born after Elvis died gets any of
> these Monty Python jokes.
I protest...Elvis isn't dead... ;-) Ev
sure, but I doubt that it is
CaptureMouse doing it, and I know the SetCapture API (which it eventually
calls) does not. Is it possible that your clicking caused some part of the
app to become unhidden, or caused some button to change state?
--
Tim Roberts, [EMAIL PROTECTED]
Providenza & Boek
font depending on your operating system and locale. 74
(0x4A) indicates a vector TrueType font of the "script" family, which is
bizarre.
May I suggest that you set your own default font before beginning?
--
Tim Roberts, [EMAIL PROTECTED]
Providenza & Boekelheide, Inc.
--
http://mail.python.org/mailman/listinfo/python-list
[Paddy]
>> http://en.wikipedia.org/wiki/Doctest
[Kaz Kylheku]
> I pity the hoplelessly anti-intellectual douche-bag who inflicted this
> undergraduate misfeature upon the programming language.
As a blind misshapen dwarf, I get far too much pity as it is, but I
appreciate your willingness to sha
but it also gives
you some great real-world examples of virtually every function.
--
Tim Roberts, [EMAIL PROTECTED]
Providenza & Boekelheide, Inc.
--
http://mail.python.org/mailman/listinfo/python-list
Soni Bergraj <[EMAIL PROTECTED]> wrote:
>
>I was just wondering if there is a more convenient way of doing a Http
>HEAD requests then the socket module?
>
>Any ideas?
The standard "httplib" module can do that in a half-dozen lines of code.
--
Tim Robert
> I've been trying to figure this one out for some time but
> with no success. I have a machine with two network
> interfaces, each with their own IP address and it's own
> domain, for example:
> - ipA on machineA.domainA
> - ipB on machineB.domainB
>
> Given any pair of IPs or hostnames (
[Simon Schuster]
> following this tutorial,
Which tutorial?
> I copied and pasted:
>
> from string import *
>
> cds = """atgagtgaacgtctgagcattagctccgtatatcggcgcacaaa
> tttcgggtgccgacctgacgcgcccgttaagcgataatcagtttgaacagctttaccatgcggtg
> ctgcgccatcaggtggtgtttctacgcgatcaagctattacgccgcagcagca
[Bill Atkins]
>> (Why are people from c.l.p calling parentheses "brackets"?)
[Kaz Kylheku]
> Because that's what they are often called outside of the various
> literate fields.
For example, the English are "outside of the various literate fields"?
FWIW, Python documentation consistently uses the
automation code
|
| Question: Is it possible to start and automate a remote GUI
| using Python?
One way might be to have something like
Pyro (http://pyro.sf.net) running on the
remote machine linked to a proxy on the local
machine.
TJG
Tim Golden
Senior Analyst
Tim Golden wrote:
[... snip horrendous company-generated sig/disclaimer ...]
Sorry about that, folks. We've started using a new
server-based sig generation thing so I'll have to start
not sending via company email!
TJG
--
http://mail.python.org/mailman/listinfo/python-list
Bell, Kevin slcgov.com> writes:
>
> If I want "C:\temp" to pop open on screen, how do I do it?
import os
os.startfile (r"c:\temp")
--
http://mail.python.org/mailman/listinfo/python-list
> Is there a simple way to to identify and remove matching pairs from 2
> lists?
>
> For example:
>
> I have
>
> a=[2, 5, 3, 4, 7, 2, 2, 4, 8, 1]
> b=[7, 3, 5, 8, 1, 7, 4, 8, 2, 6]
>
> and I want to get this:
>
> a=[2, 5, 3, 4, 7, 2, 8, 1]
> b=[7, 3, 5, 8, 1, 4, 2, 6]
Well, with a few caveats
*nix?
Thanks,
Tim Daneliuk [EMAIL PROTECTED]
PGP Key: http://www.tundraware.com/PGP/
--
http://mail.python.org/mailman/listinfo/python-list
[Tim Daneliuk]
> I have a program wherein I want one behavior when a file is
> set as executable and a different behavior if it is not. Is
> there a simple way to determine whether a given named file is
> executable that does not resort to all the lowlevel ugliness
> of os.sta
[Christoph Zwerschke]
> And can somebody explain what is exactly meant with
> "homogenous data"?
This seems to have been explained a few times
recently :) Basically, if you have a "list of xs"
and remove one item from it, it is still a "list of xs",
where "xs" might be people, coordinate-pairs, n
mthorley wrote:
> Greetings, I'm looking for a python module that will take a datetime
> obj and convert it into relative time in english.
> For example: 10 minutes ago, 1 Hour ago, Yesterday, A few day ago, Last
> Week, etc
For the very little it's worth, I offer the following:
http://timgolden.
>> I've tried
>> ''
>> but that didn't work properly. I'm fairly basic in my knowledge of
>> Python, so I'm still trying to learn re.
>> What pattern would work?
>
> I use re.compile("",re.DOTALL)
> for scripts. I strip this out first since my tag stripping re will
> strip out script tags as we
Tim Golden wrote:
> [Tim Daneliuk]
>> I have a program wherein I want one behavior when a file is
>> set as executable and a different behavior if it is not. Is
>> there a simple way to determine whether a given named file is
>> executable that does not resort to all
On 15/12/06, Benjamin Georgi <[EMAIL PROTECTED]> wrote:
> Hello list,
>
> I could use some help extracting the keys/values of a list of
> dictionaries from a string that is just the str() representation of the
> list (the problem is related to some flat file format I'm using for file
> IO).
>
> Exa
choices=C_CHOICES)
> homezip = Q_Zip("Your zip code?", "homezip", required=True, )
> happy = Q_Bool("Are you happy?", "happy", default=False)
> birthday = Q_Date("Your Birthday:", "birthda
Tim Daneliuk <[EMAIL PROTECTED]> wrote:
>
>This seems to work, at least approximately:
>
> os.stat(selected)[ST_MODE] & (S_IXUSR|S_IXGRP|S_IXOTH
>
>It probably does not catch every single instance of something
>that could be considered "executable"
'twander' Version 3.204 is now released and available for download at:
http://www.tundraware.com/Software/twander
The last public release was 3.195.
If you are unfamiliar with this program, see the end of this message
for a brief description.
--
On 16/12/06, g.franzkowiak <[EMAIL PROTECTED]> wrote:
> Hi everybody,
>
> have a little problem with a service on Win32.
>
> I use a TCP server as service, but can't access from an other machine.
> Only local access is possible.
>
> The service starts like this:
>
> -> myService.py --username user
> Comparing file system paths as strings is very brittle. Is there a
> better way to test if two paths point to the same file or directory
> (and that will work across platforms?)
os.path.samefile(filename1, filename2)
os.path.sameopenfile(fileobject1, fileobject2)
-tkc
--
htt
>> Comparing file system paths as strings is very brittle.
>
> Why do you say that? Are you thinking of something like this?
>
> /home//user/somedirectory/../file
> /home/user/file
Or even
~/file
> How complicated do you want to get? If you are thinking about aliases,
> hard links, sho
>>> Comparing file system paths as strings is very brittle. Is there a
>>> better way to test if two paths point to the same file or directory
>>> (and that will work across platforms?)
>> os.path.samefile(filename1, filename2)
>> os.path.sameopenfile(fileobject1, fileobject2)
>
> Nice t
Sandra-24 wrote:
> Comparing file system paths as strings is very brittle. Is there a
> better way to test if two paths point to the same file or directory
> (and that will work across platforms?)
I suspect that the "and that will work across platforms"
parenthesis is in effect a killer. However,
> The current setup will not "silently fail when run on win32". How could
> it? It doesn't exist; it can't be run.
Ah...didn't know which it did (or didn't do) as I don't have a
win32 box at hand on which to test it.
In chasing the matter further, the OP mentioned that their
particular problem
"Gabriel Genellina" <[EMAIL PROTECTED]> wrote:
>On 16 dic, 04:47, Tim Roberts <[EMAIL PROTECTED]> wrote:
>> > os.stat(selected)[ST_MODE] & (S_IXUSR|S_IXGRP|S_IXOTH
>
>>This will tell you that "x.exe" is executable, even if "x.exe&qu
"[EMAIL PROTECTED]" <[EMAIL PROTECTED]> wrote:
>
>It seems that an array acts like an list very much, except it doesn't
>have a method sort.
What do you mean by "array"? There is no such beast in the Python
language. Do you mean the library module &q
Roger Upole wrote:
> Gabriel Genellina wrote:
>> On 16 dic, 04:47, Tim Roberts <[EMAIL PROTECTED]> wrote:
>>>> os.stat(selected)[ST_MODE] & (S_IXUSR|S_IXGRP|S_IXOTH
>>> This will tell you that "x.exe" is executable, even if "x.exe" cont
> I have a string named text. I need to extract a substring from it
> starting by variable 's' and ending by 'e'.
>
> text[s:e] generates the following error:
>
> TypeError: slice indices must be integers or None
Your syntax is correct...the error you get back is the clue:
either "s" or "e
on defined and run that program if there is.
b) If the file *is* "executable", run it.
So ... all I really needed to know is whether or not the OS thinks the
file is executable. Obvious - and this is true on most any system -
you can create the situation where the file appear execu
Gabriel Genellina wrote:
> At Monday 18/12/2006 13:41, Tim Daneliuk wrote:
>
>> I was working on a new release and wanted to add file associations
>> to it. That is, if the user selected a file and double clicked or
>> pressed Enter, I wanted the following behavior (i
;
> Thank you.
I have run that exact installer many many times and it works fine. to
use SHA-256 with pycrypto:
>>> from Crypto.Hash import SHA256
>>> sha = SHA256.new()
>>> sha.update('message')
>>> sha.hexdigest() # sha.digest gives the raw form
'ab530a13e45914982b79f9b7e3fba994cfd1f3fb22f71cea1afbf02b460c6d1d'
cheers
tim
--
http://mail.python.org/mailman/listinfo/python-list
(Apologies for two releases in less than a week. It was, um...
necessary. This should be it for quite a while barring any notable
bug reports.)
'twander' Version 3.210 is now released and available for download at:
http://www.tundraware.com/Software/twander
The last public release wa
tarted
>with, there are a few gotchas. You're above snippet should be:
>
>class HelloWorld(object):
> def index(self):
> return "Hello World"
> index.exposed = True
Many people find it more readable to write that as:
class HelloWorld(object):
@
[EMAIL PROTECTED]
> Python dict is a hash table, isn't it?
Yup.
> I know that hashtable has the concept of "bucket size" and "min bucket
> count" stuff,
Some implementations of hash tables do. Python's does not. Python's
uses what's called "open addressing" instead.
> and they should be confi
a Windows system, using stat,
the definition is "has an extension that is in PATHEXT". Nothing more,
nothing less. In both cases, the contents of the file are irrelevant.
Now, when you, as a human being, try answer the question "is this file
executable", you would use more s
3601 - 3700 of 7567 matches
Mail list logo
