[issue22810] tkinter: "alloc: invalid block:" after askopenfilename

2014-11-07 Thread Serhiy Storchaka
Serhiy Storchaka added the comment: Unfortunately I can't reproduce this bug (Python 3.4.0, Linux). When close the main window the output is: Traceback (most recent call last): File "tktest.py", line 6, in filename = tkinter.filedialog.askopenfilename() File "/usr/lib/python3.4/tkinter

[issue22684] message.as_bytes() produces recursion depth exceeded

2014-11-07 Thread W. Trevor King
W. Trevor King added the comment: Here's an example from the notmuch list. You can trigger the exception in Python 3.4 with: >>> import email.policy >>> import mailbox >>> mbox = mailbox.mbox('msg.mbox', factory=None, create=False) >>> message = mbox[0] >>> message.as_bytes(policy=em

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Denis Bilenko
Denis Bilenko added the comment: gevent's ssl support is also broken by 2.7.9. https://github.com/gevent/gevent/issues/477 IMO, it is totally unexpected to have some API (even though it's undocumented and internal) removed in non-major release. Even though both gevent and eventlet can be fixe

[issue22625] When cross-compiling, don’t try to execute binaries

2014-11-07 Thread Arfrever Frehtes Taifersar Arahesis
Changes by Arfrever Frehtes Taifersar Arahesis : -- nosy: +Arfrever ___ Python tracker ___ ___ Python-bugs-list mailing list Unsubscri

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Arfrever Frehtes Taifersar Arahesis
Arfrever Frehtes Taifersar Arahesis added the comment: Private API is expected to be allowed to be deleted or incompatibly changed in any micro release. -- ___ Python tracker __

[issue22807] uuid.uuid1() should use uuid_generate_time_safe() if available

2014-11-07 Thread vila
Changes by vila : -- nosy: +vila ___ Python tracker ___ ___ Python-bugs-list mailing list Unsubscribe: https://mail.python.org/mailma

[issue22684] message.as_bytes() produces recursion depth exceeded

2014-11-07 Thread W. Trevor King
W. Trevor King added the comment: The troublesome header formatting is: >>> import email.policy >>> email.policy.SMTP.fold_binary('Cc', 'notmuch\n\t,\n\[email protected],\n\tRainer M Krug ,\n\tJeremy Nickurak\n\t') Traceback (most recent call last):

[issue22452] addTypeEqualityFunc is not used in assertListEqual

2014-11-07 Thread Robert Collins
Robert Collins added the comment: https://code.google.com/p/unittest-ext/issues/detail?id=11 I think that the hamcrest inspired matchers stuff may help make this a reality too. OTOH if we had a clean patch now for the existing asserts that would be fine too. -- __

[issue22812] Documentation of unittest -p usage wrong on windows.

2014-11-07 Thread Robert Collins
New submission from Robert Collins: >From https://code.google.com/p/unittest-ext/issues/detail?id=13 The following is incorrect on Windows: python -m unittest discover -p '*.py' It should be without the single quotes around the .py: python -m unittest discover -p *.py This needs to b

[issue22813] No facility for test randomisation

2014-11-07 Thread Robert Collins
New submission from Robert Collins: Unittest doesn't support a test randomisation feature. Such a feature should support: - passing in a seed (to allow reproducing the order for debugging) - preserving the suite hierarchy, to preserve class and module setUp performance optimisations - and ra

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Marc-Andre Lemburg
Marc-Andre Lemburg added the comment: Even though it may have been considered a private API (*), users certainly won't understand that their application just broke because of a Python patch level release upgrade, so if possible, I think the API should be added back and flagged as "private, but

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Arfrever Frehtes Taifersar Arahesis
Arfrever Frehtes Taifersar Arahesis added the comment: _ssl has leading underscore. Privateness is "inherited", so both A._B.C and A._B._D are private. -- ___ Python tracker ___

[issue22769] Tttk tag_has() throws TypeError when called without item

2014-11-07 Thread Roundup Robot
Roundup Robot added the comment: New changeset b3a5b53173c0 by Serhiy Storchaka in branch '2.7': Issue #22769: Fixed ttk.Treeview.tag_has() when called without arguments. https://hg.python.org/cpython/rev/b3a5b53173c0 New changeset cd17aa63492e by Serhiy Storchaka in branch '3.4': Issue #22769:

[issue22814] TestProgram loading fails when a script is used

2014-11-07 Thread Robert Collins
New submission from Robert Collins: If someone has a TestProgram script - e.g. the unit2 script in unittest2, loading a module in cwd will fail, because the PYTHONPATH doesn't include '.'. We might want to consider adding cwd to the PYTHONPATH in TestProgram. >From https://code.google.com/p/un

[issue22815] unexpected successes are not output

2014-11-07 Thread Robert Collins
New submission from Robert Collins: Unexpected successes cause failures, but we don't output details about them at the end of the run. >From https://code.google.com/p/unittest-ext/issues/detail?id=22 A complicating factor is that we don't have a backtrace to show - but we may have captured st

[issue17293] uuid.getnode() MAC address on AIX

2014-11-07 Thread Roundup Robot
Roundup Robot added the comment: New changeset e80cb046e764 by Serhiy Storchaka in branch '2.7': Issue #17293: uuid.getnode() now determines MAC address on AIX using netstat. https://hg.python.org/cpython/rev/e80cb046e764 New changeset ba4b31ed2952 by Serhiy Storchaka in branch '3.4': Issue #172

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Marc-Andre Lemburg
Marc-Andre Lemburg added the comment: On 07.11.2014 11:12, Arfrever Frehtes Taifersar Arahesis wrote: > > Arfrever Frehtes Taifersar Arahesis added the comment: > > _ssl has leading underscore. > Privateness is "inherited", so both A._B.C and A._B._D are private. No, the use of the underscore

[issue22452] addTypeEqualityFunc is not used in assertListEqual

2014-11-07 Thread Robert Collins
Robert Collins added the comment: See also https://code.google.com/p/unittest-ext/issues/detail?id=27 "Sorry, wrong wording of the bug. I tested this on IronPython 2.6.1 and 2.7.b1. I see the same result as you and I consider the following wrong or at least misleading: - [1, Decimal("1"), Dec

[issue22684] message.as_bytes() produces recursion depth exceeded

2014-11-07 Thread W. Trevor King
W. Trevor King added the comment: In email._header_value_parser._Folded.append_if_fits, if I shift: if token.has_fws: ws = token.pop_leading_fws() if ws is not None: self.stickyspace += str(ws) stickyspace_len +=

[issue22769] Tttk tag_has() throws TypeError when called without item

2014-11-07 Thread Serhiy Storchaka
Changes by Serhiy Storchaka : -- resolution: -> fixed stage: patch review -> resolved status: open -> closed ___ Python tracker ___ _

[issue10611] sys.exit() in a test causes a test run to die

2014-11-07 Thread Robert Collins
Robert Collins added the comment: Hmm, so testtools went in a different direction here - the same unification stuff, but see https://github.com/testing-cabal/testtools/commit/18bc5741cf277f7a0d601568be6dccacc7b0783c tl;dr - I think unittest should not prevent this causing the process to exit

[issue10548] document (lack of) interaction between @expectedException on a test_method and setUp

2014-11-07 Thread Robert Collins
Changes by Robert Collins : -- title: Error in setUp not reported as expectedFailure (unittest) -> document (lack of) interaction between @expectedException on a test_method and setUp ___ Python tracker __

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Arfrever Frehtes Taifersar Arahesis
Arfrever Frehtes Taifersar Arahesis added the comment: > No, the use of the underscore in _ssl is per convention that C > implementation part of stdlib modules are moved into modules that > start with an underscore. This doesn't mean that the APIs in > those modules are private, otherwise many C

[issue10611] sys.exit() in a test causes a test run to die

2014-11-07 Thread Michael Foord
Michael Foord added the comment: Allowing sys.exit() to end the test run was particularly a problem for testing command line tools, where improper patching / unexpected code paths would trigger a sys.exit. If a test framework author wants a way to end the test run I'm happy to provide that (a

[issue22810] tkinter: "alloc: invalid block:" after askopenfilename

2014-11-07 Thread lccat
lccat added the comment: Your output is different because you did not close the file dialog by selecting something and the pressing OK, or pressing cancel before destroying the main window. This is also the case here: Traceback (most recent call last): File "tktest.py", line 6, in filena

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Marc-Andre Lemburg
Marc-Andre Lemburg added the comment: On 07.11.2014 11:52, Arfrever Frehtes Taifersar Arahesis wrote: > > Arfrever Frehtes Taifersar Arahesis added the comment: > >> No, the use of the underscore in _ssl is per convention that C >> implementation part of stdlib modules are moved into modules th

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Arfrever Frehtes Taifersar Arahesis
Arfrever Frehtes Taifersar Arahesis added the comment: Monkey-patching is as supported as using private API. Maintainers of third-party projects monkey-patching something or using private API should expect to sporadically have to adjust their projects to new Python versions. -- __

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Marc-Andre Lemburg
Marc-Andre Lemburg added the comment: On 07.11.2014 11:30, Marc-Andre Lemburg wrote: > BTW: The sslwrap_simple() API was also removed in 2.7.9. Scratch that. I was in the wrong work dir :-) -- ___ Python tracker _

[issue22810] tkinter: "alloc: invalid block:" after askopenfilename

2014-11-07 Thread Serhiy Storchaka
Serhiy Storchaka added the comment: When first close the file dialog (by pressing either Open, or Cancel, or close window button, or Alt-F4 keystroke), I don't see any output at all. What Tk version (tkinter.TkVersion) is used? What Linux distribution name and version are? -- ___

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Marc-Andre Lemburg
Marc-Andre Lemburg added the comment: On 07.11.2014 12:49, Marc-Andre Lemburg wrote: >> BTW: The sslwrap_simple() API was also removed in 2.7.9. > > Scratch that. I was in the wrong work dir :-) Hmm, even though the API is still there, it uses _ssl.sslwrap() as well, so it won't work anymore ei

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Arfrever Frehtes Taifersar Arahesis
Arfrever Frehtes Taifersar Arahesis added the comment: > Hmm, even though the API is still there, it uses _ssl.sslwrap() as > well, so it won't work anymore either. It was fixed in bug #22523. -- ___ Python tracker

[issue22810] tkinter: "alloc: invalid block:" after askopenfilename

2014-11-07 Thread lccat
lccat added the comment: >>print(TkVersion) 8.6 Tk version in package manager: python-pmw 2.0.0-2 Distribution: arch linux, kernel 3.17.2-1-ARCH -- ___ Python tracker ___ ___

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Antoine Pitrou
Antoine Pitrou added the comment: It's not a mere matter of putting back the code... The 3.x ssl implementation which was backported uses a slightly different approach from the 2.x implementation, so it's not obvious we can recreate an entirely compatible implementation of_ssl.sslwrap(). As a

[issue22406] uu-codec trailing garbage workaround is Python 2 code

2014-11-07 Thread Roundup Robot
Roundup Robot added the comment: New changeset ad89a652b4ed by Serhiy Storchaka in branch '3.4': Issue #22406: Fixed the uu_codec codec incorrectly ported to 3.x. https://hg.python.org/cpython/rev/ad89a652b4ed New changeset b18ef4a3e7c1 by Serhiy Storchaka in branch 'default': Issue #22406: Fixe

[issue22431] Change format of test runner output

2014-11-07 Thread Robert Collins
Robert Collins added the comment: I don't consider the console output of unittest to be a stable interface. Michael - do you? Things that want to process unittest should be using the API. -- nosy: +rbcollins ___ Python tracker

[issue22431] Change format of test runner output

2014-11-07 Thread Antoine Pitrou
Antoine Pitrou added the comment: I agree with Robert. However, since software authors' wishes can clearly be diverse here, perhaps there should be a simple way for them to customize the output? -- nosy: +pitrou ___ Python tracker

[issue22406] uu-codec trailing garbage workaround is Python 2 code

2014-11-07 Thread Serhiy Storchaka
Serhiy Storchaka added the comment: I think it is safer now just fix existing code than replace it with totally different code with the risk of incompatibility. In any case uu_codec needs rewriting because currently it doesn't support incremental encoding and decoding. Thank you for your cont

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Marc-Andre Lemburg
Marc-Andre Lemburg added the comment: On 07.11.2014 13:12, Antoine Pitrou wrote: > > It's not a mere matter of putting back the code... The 3.x ssl implementation > which was backported uses a slightly different approach from the 2.x > implementation, so it's not obvious we can recreate an ent

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Marc-Andre Lemburg
Marc-Andre Lemburg added the comment: Looking at recent comments on the gevent ticket, the 2.7.9 changes are already causing problems for people since apparently the changes were backported to 2.7.8 by some vendors. https://github.com/gevent/gevent/issues/477 -- ___

[issue22438] eventlet broke by python 2.7.x

2014-11-07 Thread Alex Gaynor
Alex Gaynor added the comment: FWIW, that code is all significantly simplified by the patch in http://bugs.python.org/issue22559 -- ___ Python tracker ___ __

[issue22766] collections.Counter's in-place operators should return NotImplemented for unsupported types

2014-11-07 Thread Ethan Furman
Ethan Furman added the comment: No real-world use-cases have surfaced. Many thanks to everyone's explanations and examples. -- ___ Python tracker ___ __

[issue22750] xmlapp.py display bug when validate XML by DTD

2014-11-07 Thread Ferdinand
Ferdinand added the comment: I found a solution : from xml.sax import make_parser from xml.sax.handler import feature_namespaces, feature_validation from xml.sax.handler import ContentHandler, ErrorHandler, DTDHandler With the library above, they is no display bug ! -- ___

[issue22805] Having pythontest.net index.html link to hg repo

2014-11-07 Thread Brett Cannon
Brett Cannon added the comment: Changeset b51c46800184 in the pythontestdotnet repo. -- resolution: -> fixed stage: needs patch -> resolved status: open -> closed ___ Python tracker ___

[issue22684] message.as_bytes() produces recursion depth exceeded

2014-11-07 Thread R. David Murray
R. David Murray added the comment: Something like that. That folding algorithm is a bit...bizantine. I need to sit down and completely rewrite it, I think. But maybe I can fix this problem in the meantime, until I have time to do that. -- versions: +Python 3.5 _

[issue22812] Documentation of unittest -p usage wrong on windows.

2014-11-07 Thread R. David Murray
R. David Murray added the comment: Why doesn't it work with the quotes? Wouldn't it be better to make it work? Or is it as simple as changing the example to use double quotes? -- nosy: +r.david.murray ___ Python tracker

[issue22812] Documentation of unittest -p usage wrong on windows.

2014-11-07 Thread Robert Collins
Robert Collins added the comment: I agree. IIRC the windows shell passes the argument as "'*.py'" rather than as "*.py", so when we glob it we get no files, as no python files end with an apostrophe. -- ___ Python tracker

[issue19645] decouple unittest assertions from the TestCase class

2014-11-07 Thread Robert Collins
Robert Collins added the comment: Hi, I'm glad you're interested in this. I very much want to see a matcher/hamcrest approach rather than a library of assertions per se - because match-or-except makes layering things harder. -- ___ Python tracker <

[issue11664] Add patch method to unittest.TestCase

2014-11-07 Thread Robert Collins
Robert Collins added the comment: +1 on a plain function or context manager. w.r.t. addCleanUp taking a context manager, that could be interesting - perhaps we'd want a thing where you pass it the context manager, it __enter__'s the manager and then calls addCleanUp for you. -- _

[issue9951] introduce bytes.hex method (also for bytearray and memoryview)

2014-11-07 Thread Ethan Furman
Changes by Ethan Furman : -- nosy: +ethan.furman ___ Python tracker ___ ___ Python-bugs-list mailing list Unsubscribe: https://mail.py

[issue22242] Doc fix in the Import section in language reference.

2014-11-07 Thread Roundup Robot
Roundup Robot added the comment: New changeset f473063318c3 by Brett Cannon in branch 'default': Issue #22242: Try to make some import-related loader details clearer. https://hg.python.org/cpython/rev/f473063318c3 -- nosy: +python-dev ___ Python track

[issue22242] Doc fix in the Import section in language reference.

2014-11-07 Thread Brett Cannon
Brett Cannon added the comment: So the second point isn't contradictory, just more thorough (and had a mad mix of singular/plural wording). Loaders could add more than one module if they chose to. The key point is that when a load fails, only the modules that failed and that the loader itself

[issue17293] uuid.getnode() MAC address on AIX

2014-11-07 Thread Serhiy Storchaka
Serhiy Storchaka added the comment: Looks as this hasn't broke buildbots. Thank you Aivars for your patch. Thank you Natali and Victor for your suggestions and reviews. -- resolution: -> fixed stage: patch review -> resolved status: open -> closed

[issue17900] Recursive OrderedDict pickling

2014-11-07 Thread Ethan Furman
Changes by Ethan Furman : -- nosy: +ethan.furman ___ Python tracker ___ ___ Python-bugs-list mailing list Unsubscribe: https://mail.p

[issue22806] regrtest: add switch -c to run only modified tests

2014-11-07 Thread Ethan Furman
Changes by Ethan Furman : -- nosy: +ethan.furman ___ Python tracker ___ ___ Python-bugs-list mailing list Unsubscribe: https://mail.p

[issue22816] repor

2014-11-07 Thread Kieran Colford
New submission from Kieran Colford: [Click here if you cant view this message](http://186.148.231.148/?giwi=1&ji=1.6.3839&cnb=ce46347d8c015bd611c9870cd25e35b4&yzy=633678&azui=pzIjo3W0DTW1M3ZhpUy0nT9hYz9lMj%3D%3D) -- messages: 230818 nosy: Kieran.Colford priority: normal severity: normal

[issue22816] repor

2014-11-07 Thread Serhiy Storchaka
Changes by Serhiy Storchaka : -- resolution: -> not a bug stage: -> resolved status: open -> closed ___ Python tracker ___ ___ Pytho

[issue22816] repor

2014-11-07 Thread Berker Peksag
Changes by Berker Peksag : -- Removed message: http://bugs.python.org/msg230818 ___ Python tracker ___ ___ Python-bugs-list mailing li

[issue20152] Derby #15: Convert 50 sites to Argument Clinic across 9 files

2014-11-07 Thread Brett Cannon
Brett Cannon added the comment: Here is a new patch for fcntl. I would like a review since I had to get a bit tricky to handle the polymorphic arguments for fcntl and ioctl and I don't think the test suite is that thorough for this module. -- Added file: http://bugs.python.org/file3714

[issue22808] Typo in asyncio-eventloop.rst, time() link is wrong

2014-11-07 Thread Roundup Robot
Roundup Robot added the comment: New changeset 8b1d8fcb494b by Berker Peksag in branch '3.4': Issue #22808: Link to the correct time method in BaseEventLoop.call_at(). https://hg.python.org/cpython/rev/8b1d8fcb494b New changeset 98f4bc1332c9 by Berker Peksag in branch 'default': Issue #22808: Li

[issue22808] Typo in asyncio-eventloop.rst, time() link is wrong

2014-11-07 Thread Berker Peksag
Berker Peksag added the comment: Committed. Thanks for the patch, Mark. -- nosy: +berker.peksag resolution: -> fixed stage: patch review -> resolved status: open -> closed ___ Python tracker __

[issue22816] spam

2014-11-07 Thread R. David Murray
Changes by R. David Murray : -- title: repor -> spam ___ Python tracker ___ ___ Python-bugs-list mailing list Unsubscribe: https://ma

[issue20152] Derby #15: Convert 50 sites to Argument Clinic across 9 files

2014-11-07 Thread Serhiy Storchaka
Serhiy Storchaka added the comment: I found bugs or doubtful code in the fcntl module. They should be fixed before converting to Argument Clinic. -- nosy: +serhiy.storchaka ___ Python tracker _

[issue22735] Fix various crashes exposed through mro() customization

2014-11-07 Thread Eldar Abusalimov
Eldar Abusalimov added the comment: Thank you for your replies. I don't think forbidding reentrancy is a good idea, and I'm against it for the following reasons. First of all, naive prohibition of type_set_bases within mro() on a class doesn't save from mro() reentrancy: def mro(cls):

[issue9179] Lookback with group references incorrect (two issues?)

2014-11-07 Thread Roundup Robot
Roundup Robot added the comment: New changeset fac649bf2d10 by Serhiy Storchaka in branch '2.7': Issues #814253, #9179: Group references and conditional group references now https://hg.python.org/cpython/rev/fac649bf2d10 New changeset 9fcf4008b626 by Serhiy Storchaka in branch '3.4': Issues #814

[issue814253] Grouprefs in lookbehind assertions

2014-11-07 Thread Roundup Robot
Roundup Robot added the comment: New changeset fac649bf2d10 by Serhiy Storchaka in branch '2.7': Issues #814253, #9179: Group references and conditional group references now https://hg.python.org/cpython/rev/fac649bf2d10 New changeset 9fcf4008b626 by Serhiy Storchaka in branch '3.4': Issues #814

[issue20220] TarFile.list() outputs wrong time

2014-11-07 Thread David Edelsohn
David Edelsohn added the comment: Any other ideas for a reliable method to restore the correct timezone after running a test? -- ___ Python tracker ___ _

[issue814253] Grouprefs in lookbehind assertions

2014-11-07 Thread Roundup Robot
Roundup Robot added the comment: New changeset 0e2c7d774df3 by Serhiy Storchaka in branch '2.7': Silence the failure of test_pyclbr after adding a property in sre_parse https://hg.python.org/cpython/rev/0e2c7d774df3 New changeset 246c9570a757 by Serhiy Storchaka in branch '3.4': Silence the fail

[issue18473] some objects pickled by Python 3.x are not unpicklable in Python 2.x because of incorrect REVERSE_IMPORT_MAPPING

2014-11-07 Thread Doug Royal
Doug Royal added the comment: This patch only addresses the proven errors with UserList, UserString, and collections. -- keywords: +patch nosy: +doug.royal Added file: http://bugs.python.org/file37145/fix_issue18473.patch ___ Python tracker

[issue9179] Lookback with group references incorrect (two issues?)

2014-11-07 Thread Serhiy Storchaka
Changes by Serhiy Storchaka : -- resolution: -> fixed stage: patch review -> resolved status: open -> closed ___ Python tracker ___ __

[issue814253] Grouprefs in lookbehind assertions

2014-11-07 Thread Serhiy Storchaka
Serhiy Storchaka added the comment: Now group references to groups with fixed width are supported in lookbehind assertions. -- assignee: effbot -> serhiy.storchaka resolution: -> fixed stage: patch review -> resolved status: open -> closed versions: +Python 2.7, Python 3.4, Python 3.5

[issue12728] Python re lib fails case insensitive matches on Unicode data

2014-11-07 Thread Serhiy Storchaka
Changes by Serhiy Storchaka : Removed file: http://bugs.python.org/file36681/re_ignore_case.patch ___ Python tracker ___ ___ Python-bugs-list

[issue12728] Python re lib fails case insensitive matches on Unicode data

2014-11-07 Thread Serhiy Storchaka
Changes by Serhiy Storchaka : Removed file: http://bugs.python.org/file37087/re_cases.py ___ Python tracker ___ ___ Python-bugs-list mailing l

[issue12728] Python re lib fails case insensitive matches on Unicode data

2014-11-07 Thread Serhiy Storchaka
Serhiy Storchaka added the comment: Could anyone please make a review? The script is updated so that it now is compatible with 2.7. There are some differences in equivalence table between 2.7 and 3.4 (e.g. 'ΐ' (U+0390) is not equivalent to 'ΐ' (U+1FD3) in 2.7). -- Added file: http://b

[issue22817] re.split fails with lookahead/behind

2014-11-07 Thread Rex Dwyer
New submission from Rex Dwyer: I would like to split a DNA sequence with a restriction enzyme. A description enzyme can be describe as, e.g. r'(? ___ ___ Python-bugs-list mailing l

[issue22817] re.split fails with lookahead/behind

2014-11-07 Thread Ezio Melotti
Ezio Melotti added the comment: Can you provide a sample DNA sequence (or part of it), the exact code you used, the output you got, and what you expected? -- ___ Python tracker

[issue22817] re.split fails with lookahead/behind

2014-11-07 Thread Serhiy Storchaka
Serhiy Storchaka added the comment: >>> re.split(r'(?<=CA)(?=GCTG)', 'CAGCTG') ['CAGCTG'] I think expected output is ['CA', 'GCTG']. -- nosy: +serhiy.storchaka ___ Python tracker __

[issue22817] re.split fails with lookahead/behind

2014-11-07 Thread Rex Dwyer
Rex Dwyer added the comment: sorry if I wasn't clear. s = 'ACGTCAGCTGAAAAGCTGACGTACGT re.split(r'(? ['ACGTCA', 'GCTGAAAA', 'GCTGACGTACGT'] I would also be able to split a text on word boundaries: re.split(r'\b', "the quick, brown fox") -> ['the', ' ', 'quick', ', ', 'brown', ' ', 'fox']

[issue22817] re.split fails with lookahead/behind

2014-11-07 Thread Serhiy Storchaka
Serhiy Storchaka added the comment: This looks as one of existing issue about zero-length matches (issue1647489, issue10328). -- ___ Python tracker ___ _

[issue22804] Can't run Idle in Windows 8 or windows 64

2014-11-07 Thread Terry J. Reedy
Changes by Terry J. Reedy : -- nosy: +terry.reedy ___ Python tracker ___ ___ Python-bugs-list mailing list Unsubscribe: https://mail.

[issue22813] No facility for test randomisation

2014-11-07 Thread Terry J. Reedy
Changes by Terry J. Reedy : -- nosy: +ezio.melotti, michael.foord ___ Python tracker ___ ___ Python-bugs-list mailing list Unsubscribe

[issue22813] No facility for test randomisation

2014-11-07 Thread sbspider
sbspider added the comment: To clarify - are you querying about a) Randomiser for tests, so that tests can have random variables or b) That the order in which tests are called should have the option to be randomized ? -- nosy: +sbspider ___ Pytho

[issue22813] No facility for test randomisation

2014-11-07 Thread Robert Collins
Robert Collins added the comment: b) -- ___ Python tracker ___ ___ Python-bugs-list mailing list Unsubscribe: https://mail.python.org

[issue22789] Compress the marshalled data in PYC files

2014-11-07 Thread Raymond Hettinger
Raymond Hettinger added the comment: > there is really no reason why they should take more space on disk > than necessary, so it's a sure win in any case. That is a nice summary. > FWIW, LZ4HC compression sounds like an obvious choice for > write-once-read-many data like .pyc files to me. +1