I'm seeing some unexpected output when I use a script (included at
end) to iterate over large text files. I am unsure of the source of
the unexpected output and any help would be much appreciated.
Background
Python v 2.7.1
Windows 7 32bit
Reading and writing to an external USB hard drive
Data fi
Thanks for the replies, I'll try to address the questions raised and
spur further conversation.
>"those numbers (4GB and 64M lines) look suspiciously close to the file and
>record pointer limits to a 32-bit file system. Are you sure you aren't
>bumping into wrap around issues of some sort?"
My
On Wed, Jul 18, 2012 at 8:04 PM, William R. Wing (Bill Wing)
wrote:
> On Jul 18, 2012, at 10:33 PM, Ryan Waples wrote:
>
>> Thanks for the replies, I'll try to address the questions raised and
>> spur further conversation.
>>
>>> "those numbers (4GB an
On Wed, Jul 18, 2012 at 8:23 PM, Lee Harr wrote:
>
>> grep ^TTCTGTGAGTGATTTCCTGCAAGACAGGAATGTCAGT$> with no results
>
> How about:
> grep TTCTGTGAGTGATTTCCTGCAAGACAGGAATGTCAGT outfile
> Just in case there is some non-printing character in there...
There are many instances of that sequence of ch
>>>
>>> If you copy those files to a different device (one that has just been
>>> scrubbed and reformatted), then copy them back and get different results
>>> with your application, you've found your problem.
>>>
>>> -Bill
>>
>> Thanks for the insistence, I'll check this out. If you have any
>>
> I count only 19 lines.
yep, you are right. My bad, I think I missing copy/pasting line 20.
>The first group has only three lines. See below.
Not so, the first group is actually the first four lines listed below.
Lines 1-4 serve as one group. For what it is worth, line four should
have 1 cha
Not sure if it meets your needs, but you should at least check out simuPOP.
On Sat, Aug 18, 2012 at 12:24 PM, Modulok wrote:
> List,
>
> I'm looking for a good genetic module. (Stable, well documented, pythonic,
> etc.)
>
> I'm writing a breeding simulator where users select parent organisms to
I'm struggling to understand how to understand/accomplish the following:
I have an set ("a" below) and a list of sets ("not_a"), how can I pass the
elements of "not_a" to set.difference() so that it it understands I want
the difference between set "a" and all the rest
set.difference says "Changed
cheers, much appreciated
-ryan
On Thu, Oct 18, 2012 at 10:52 PM, Emile van Sebille wrote:
> On 10/18/2012 10:38 AM, Ryan Waples wrote:> I'm struggling to understand
> how to understand/accomplish the following:
>
> >
> > I have an set ("a" below) and a
Not sure how stuck you are to python (I have no doubt it can tackle this)
but this is very much the sort of thing that 'R' is *really* good at.
Just FYI.
Good luck
Ryan
___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
Python 2.7.x on Windows 7.
I'm looking for a bit of advice, not sure how to proceed.
With Python I am generating a file with a bunch of data in it. I want to
analyse the data in this file with three separate programs. Each of these
programs is single threaded needs only read access to the data,
Thanks, that may be just what I'm looking for.
-ryan
On Mon, Aug 5, 2013 at 12:26 PM, Chris Down wrote:
> On 2013-08-05 12:17, Ryan Waples wrote:
> > Currently I am calling each analysis program one at a time with
> > subprocess.call(). This is working without a hitch,
12 matches
Mail list logo
