I found that VPython is not in PyPI(python packet index from www.python.org).
Why ?
Dae James___
Tutor maillist - Tutor@python.org
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor
On 17/10/2012 09:23, Dae James wrote:
I found that VPython is not in PyPI(python packet index from www.python.org).
Why ?
Dae James
The author(s) have chosen not to place it there.
--
Cheers.
Mark Lawrence.
___
Tutor maillist - Tutor@python.or
On 17/10/2012 03:22, Alexander wrote:
On Tue, Oct 16, 2012 at 20:43 EST, Mark Lawrence
wrote:
For the record Access is not a database, or so some geezer called Alex
Martelli reckons http://code.activestate.com/lists/python-list/48130/, so
please don't shoot the messenger:)
Cheers.
Mark Lawrence
On Tue, Oct 16, 2012 at 11:59 PM, Monte Milanuk wrote:
>
> address = list(row)
> address.append(person)
> row = tuple(address)
The rows from the csv.reader are already lists. Also, the parameter
list in the 2nd argument only needs to be a sequence (e.g. tuple,
list, string
If your app has a standard usage of phrases, you can place a file in
that translates a tag into a particular language phrase.
if submit_tag_selection == 'english':
submit = 'Submit'
if submit_tag_selection == 'english':
submit = 'Soumettre'
Of course this could be done without the if
__
>>> I'm not a professional programmer, so I might be way off base here.
You mean you haven't dealt with this subject yet...
But what I like about Pythons modulo solution is that I can use it to
right and left shift in lists or tuples, and I will link
On Tue, Oct 16, 2012 at 12:57 PM, Abhishek Pratap
wrote:
> Hi Guys
>
> For my problem I need to store 400-800 million 20 characters keys in a
> dictionary and do counting. This data structure takes about 60-100 Gb
> of RAM.
> I am wondering if there are slick ways to map the dictionary to a file
>
Hello,
I am using python to calculate distances across the cell.
I used this command: python calculate_distances.py
This was the response:
Traceback (most recent call last):
file "calculate_distances.py" line 4, in
import celltool.simple_interface as si
ImportError: No module named celltool.simp
please send me the program for the following que:
Write a program that asks the user for a dollar amount.It then reports the
corresponding number of euros by using the current exchange rate.
--
Regards,
Tharuni Dheeraj
___
Tutor maillist - Tutor@python
On Oct 7, 2012, at 8:06 PM, Dave Angel wrote:
> On 10/07/2012 08:00 PM, Jan Karel Schreuder wrote:
>>
>>
>> On Oct 7, 2012, at 7:24 PM, Dave Angel wrote:
>>
>>
>
>>>
>>> It still makes no sense to me. There are at least two equally silly
>>> ways to define the results of a nega
Hi,I am trying to develop a python code that takes a character string as input
and finds for the occurrence of letters that are occurring thrice or more
consecutively.For E.g.
a = 'ataattaaacagagtgagcagt'In the output I want a list of those
characters that are occuring thrice or more.
Hello, I'm using Python 2.6 to generate switch lists for a model railroad.
I had some help before, possibly from this site but have encountered
another problem. I realise the code could be better written, but learning
Python is a work in progress. The program works much as expected except
when I t
tutor-requ...@python.org编写：
>Send Tutor mailing list submissions to
> tutor@python.org
>
>To subscribe or unsubscribe via the World Wide Web, visit
> http://mail.python.org/mailman/listinfo/tutor
>or, via email, send a message with subject or body 'help' to
> tutor-requ...@pyth
On Thu, Oct 11, 2012 at 3:29 PM, Stephen Hooker wrote:
>
> I try to store 1 result it works fine. If I try to store more than 1 result
> I get one or the other, never both. The code is below (not the whole
> program)
>
> for i in range(2):
> pos = random.randrange(0,len(rolling_stock_OS))
> pick =
On 17/10/12 19:23, Dae James wrote:
I found that VPython is not in PyPI(python packet index from
www.python.org). Why ?
You'd have to ask the author of VPython. Being on PyPI is not
compulsory, nobody is going to force him to use PyPI if he
doesn't want to.
--
Steven
On 08/10/2012 16:55, Tharuni Dheeraj wrote:
please send me the program for the following que:
Write a program that asks the user for a dollar amount.It then reports the
corresponding number of euros by using the current exchange rate.
--
Regards,
Tharuni Dheeraj
__
On 17/10/12 12:30, Dwight Hutto wrote:
My inexperienced advice would be to begin with the storage areas
available. I would begin by eliminating certain things such as:
x = {'one_entry' : 1}
into
x = {'one_entry':1}
Those two entries are exactly the same. The presence of absence of
spaces,
On 10/13/2012 07:02 AM, syed zaidi wrote:
> Hi,I am trying to develop a python code that takes a character string as
> input and finds for the occurrence of letters that are occurring thrice or
> more consecutively.For E.g.
> a = 'ataattaaacagagtgagcagt'In the output I want a list of tho
On 10/05/2012 11:55 PM, Benjamin Lee wrote:
> Hello,
> I am using python to calculate distances across the cell.
> I used this command: python calculate_distances.py
> This was the response:
> Traceback (most recent call last):
> file "calculate_distances.py" line 4, in
> import celltool.simple_
On Wed, Oct 17, 2012 at 8:02 AM, Dave Angel wrote:
>
> Is this a homework assignment where you might be expected to build a
> complex loop, or is it a problem you're solving where you would be
> allowed to use itertools.groupby ?
May as well post a groupby solution. I doubt it would be accepted f
Thanks for the help! Not sure why I assumed that csv.reader was returning
row as a tuple instead of a list... that makes that part easier ;)
As for the 'INSTEAD OF' trigger on a VIEW... that *does* look pretty
handy. I was trying to remember why I hadn't heard of that before, or why
I hadn't loo
On 10/8/2012 11:55 AM, Tharuni Dheeraj wrote:
please send me the program for the following que:
Write a program that asks the user for a dollar amount.It then reports
the corresponding number of euros by using the current exchange rate.
As the list name (Tutor) suggests we are here to help yo
On 17/10/12 11:29, Cheng wrote:
I couldn't see any comment or question in there.
When posting could you please follow the instructions:
When replying, please edit your Subject line so it is more specific
than "Re: Contents of Tutor digest..."
And also delete any irrelevant content. It makes
Mike,
A brief comment before I start:
your post would be a lot more readable and understandable if you were to
break it up into smaller paragraphs, each of which explains one point.
Otherwise it is a great wall of text which is fairly intimidating.
On 18/10/12 06:51, Mike wrote:
My program i
>From Programming in Python 3, 2nd edition (p. 22-23):
>>> a = ["Retention", 3, None]
>>> b = ["Retention", 3, None]
>>> a is b
False
>>> b = a
>>> a is b
True
My current understanding is as follows: On the first two lines, two
separate objects are defined, stored in two separate blocks of memory
On 10/17/2012 11:41 PM, boB Stepp wrote:
> >From Programming in Python 3, 2nd edition (p. 22-23):
>
a = ["Retention", 3, None]
b = ["Retention", 3, None]
a is b
> False
b = a
a is b
> True
>
> My current understanding is as follows: On the first two lines, two
> separate ob
26 matches
Mail list logo
