Hi ,
Can i save a file with a desired extension??
for ex: I have a .csv file (test.csv) and i want to save this file as test.xls from a python script.
Thanx in advance
ac
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listi
what are the benefits of building python from source file?
any difference if using installer?
Linda
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
Hi,
I want to go back after signal handler to the isntruction where I was
stuck. Below is the code I'm trying to play with.
#!/usr/bin/env python
### Start of code ###
import os, signal
def handler(signum, frame):
print "Signum: ", signum
return
signal.signal(signal.SIGALRM,handler)
Alan Gauld <[EMAIL PROTECTED]> schrijft:
> However the real question I have is how you intend to
> access that result value. Is it a single value at the end
> you want or the cumulative set of values from each
> scheduled call?
:)
Alan,
Currently I'm not quite sure what and how I want to
Anna Ravenscroft <[EMAIL PROTECTED]> schrijft:
> On 3/5/06, ingo <[EMAIL PROTECTED]> wrote:
> >
> > in news:[EMAIL PROTECTED] Kent Johnson wrote:
> > [...]
> > >>>
> > >>>main(printtime(strf=None))
> > >>>
> > >>>[...]
> > >>
> > >> Anna,
> > >>
> > >> that results in an syntax error / in
Danny Yoo <[EMAIL PROTECTED]> schrijft:
> But since the scheduler runs in a separate loop than the rest of your
> program, trying to return a value between the two won't work very well.
>
>
> However, there are other approaches: we can use some kind of shared
> container or communication c
Hello all,
Im writing about a topic which was discussed previously on this mailing list but didn't seem to be answered..
Bernd Prager asked whether the curses modules in Python had
functionality like that of delwin() in the C libraries. He also
supplied the below code sample to demonstrate the
I have many notepad documents that all contain long chunks of genetic
code. They look something like this:
atggctaaactgaccaagcgcatgcgtgttatccgcgagaaagttgatgcaaccaaacag
tacgacatcaacgaagctatcgcactgctgaaagagctggcgactgctaaattcgtagaa
agcgtggacgtagctgttaacctcggcatcgacgctcgtaaatctgaccagaacgtacgt
gg
Hey,I am currently working on a final year project in college
building a 3-D virtual model of a building in a python based program
called Vizard. I have prepared a set of tutorials on powerpoint which i
would like to access by clicking on various objects in the building.
e.g. Click on a Window/Air
On Mon, 6 Mar 2006, linda.s wrote:
> what are the benefits of building python from source file? any
> difference if using installer?
Hi Linda,
If a binary installer is available for your platform, you'll probably want
to stick with it. It provides the most convenient way to get Python.
Som
On Mon, 6 Mar 2006, Hameed U. Khan wrote:
> I want to go back after signal handler to the isntruction where I was
> stuck. Below is the code I'm trying to play with.
Hi Hameed,
Here's a small test program that shows that the signal handling does go
back to where we left off:
Rob Lane wrote:
> Hey,
>
> I am currently working on a final year project in college building a 3-D
> virtual model of a building in a python based program called Vizard. I
> have prepared a set of tutorials on powerpoint which i would like to
> access by clicking on various objects in the buil
> for every workingday of a week:
> from 7.00 until 17.00:
>every minute:
> capture a frame and save it
>at noon:
> compile a video from the frames gathered this morning
> do some file manipulations
>at 17.00:
> compile a video from the frames gathered this afternoo
sjw28 wrote:
> I have many notepad documents that all contain long chunks of genetic
> code
> I've tried various ways of doing this but keep coming unstuck along the
> way. Has anyone got any suggestions for how they would tackle this
> problem?
> Thanks for any help recieved!
You really
Hi,
I just took this test on Tickle.com. To see how I scored, take the test.
The Super IQ Test
http://web.tickle.com/invite?test=3046&type=t
Your score will be shown to me, too.
Gavin
___
Tutor maillist - Tutor@python.org
http://mail.python.org/ma
On 3/6/06, sjw28 <[EMAIL PROTECTED]> wrote:
I have many notepad documents that all contain long chunks of geneticcode. They look something like this:atggctaaactgaccaagcgcatgcgtgttatccgcgagaaagttgatgcaaccaaacagtacgacatcaacgaagctatcgcactgctgaaagagctggcgactgctaaattcgtagaa
agcgtggacgtagctgttaacctcggcat
> I have many notepad documents that all contain long chunks of genetic
> code. They look something like this:
>
> atggctaaactgaccaagcgcatgcgtgttatccgcgagaaagttgatgcaaccaaacag
[data example cut]
> Basically, I want to design a program using python that can open and
> read these documents.
Hello
On 6 Mar 2006 [EMAIL PROTECTED] wrote:
> I just took this test on Tickle.com. To see how I scored, take the test.
[advertisement cut]
I don't mean to be dull, but what does this have to do with Python?
If it doesn't have anything to do with learning Python or programming,
let's keep it off th
I believe it is just spam pretending to be a legit invitation, that made
it to the list.
Hugo
___
Tutor maillist - Tutor@python.org
http://mail.python.org/mailman/listinfo/tutor
Hello,
.xls is a proprietary format used by Microsoft office, and unless you
have the specs for that format and are willing to implement them (very
very hard) it would not make much sense.
If you absolutely need that, then maybe a macro in VBA from Excel itself
may be a better option.
Ch
On 2006/3/06, Alan Gauld wrote:
>> for every workingday of a week:
>> [...]
>> week
>> ...
>
>To be honest I'd do this with a series of separate scripts triggered
by the
>OS - either cron on Unix or at in Windows...
To be honest, I had my share of troubles with AT, so I try to stay away
from
Here's one approach to the problem (using bogus codon values).
-Original Message-
From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On
Behalf Of sjw28
Sent: Monday, March 06, 2006 8:37 AM
To: tutor@python.org
Subject: [Tutor] Analysing genetic code (DNA) using python
I have many note
On Mon, 6 Mar 2006, [ISO-8859-1] Hugo Gonz�lez Monteverde wrote:
> I believe it is just spam pretending to be a legit invitation, that made
> it to the list.
Followup: Gavin later sent a reply apologizing to the list --- maybe he
got a virus? --- but it didn't make it through since it was addre
Hi Anna,
Let's see one thing at a time.
wrote:
> ** If the three base pairs were UUU the value assigned to it (from the
> codon value table) would be 0.296
This can be done in Python, and one appropriate tool may be a dictionary
such as:
>>>
dna_table = {
"UUU" : 0.296,
"GG
arun wrote:
> Hi ,
> Can i save a file with a desired extension??
> for ex: I have a .csv file (test.csv) and i want to save this file as
> test.xls from a python script.
It's easy to rename a file, or read it and save it with whatever name
you like, but that won't convert it to an actual Exc
> To be honest, I had my share of troubles with AT, so I try to stay away
> from it. No unix box here, so ...
so... download cygwin!
including a fully functioning cron.
I can't imagine life on Windoze without cygwin :-)
Alan G.
___
Tutor maillist -
On 07/03/06, Alan Gauld <[EMAIL PROTECTED]> wrote:
> I can't imagine life on Windoze without cygwin :-)
Agreed --- but the new Microsoft shell looks very interesting.
Ars has a good review of it here: http://arstechnica.com/guides/other/msh.ars
It borrows from all over the place, including Perl,
Lloyd/David and all,
I'm still seeing something a bit weird with sending commands back to the
router via tn.write(). This is with python 2.4.2
As per David's last email I replaced:
tn.read_until('#')
for item in lines:
x = item
tn.write(x)
With:
blob = string.join(lines)
print blob
On Tue, 2006-03-07 at 11:31 +1000, STREET Gideon (SPARQ) wrote:
> Enter configuration commands, one per line. End with CNTL/Z.
> switch01(config)#banner exec ^
>
> ##
>
> switch01
>
> Level XX, XX Some Street, Somewhe
On Tue, 2006-03-07 at 13:39 +1000, STREET Gideon (SPARQ) wrote:
> The second banner exec is red, the previous commands I send are in
> green. So I take it to mean that it is an echo produced by the router.
> MMmm strange as the echo is overwriting what I'm sending initially.
Well the device is de
Hello,
I have a problem finding specific words.
I would like to filter out a word or replace it in a file.
I notices that the re module is good for finding patterns.
I am trying to filter out a word from strings, but having a little trouble.
I was wondering if I can search a string for a specific
On Mon, Mar 06, 2006 at 02:46:36PM +0530, arun wrote:
> Can i save a file with a desired extension??
> for ex: I have a .csv file (test.csv) and i want to save this file as
> test.xls from a python script.
Just changing the file extension from .csv to .xls won't change the file
format.
OpenOf
I'm trying just for fun to do a Game of life GUI, and want it to be a random size (later specified through some text field or something).So far it's working, but now I want to make each button clickable, so the button switches between true or false. But I can't find out how to do it. So any help wo
33 matches
Mail list logo