Sorry, I meant `[.gene`
where gene would be your new class. -s On Wed, Dec 24, 2008 at 11:00 AM, Stavros Macrakis <macra...@alum.mit.edu>wrote: > You might consider using the 'bit' library and use two bits per base. You > could then wrap this in an object with appropriate functions (bit.`[`, > etc.). > > -s > > > On Wed, Dec 24, 2008 at 10:26 AM, Gundala Viswanath <gunda...@gmail.com>wrote: > >> Dear all, >> >> What's the R way to compress the string into smaller 2~3 char/digit >> length. >> In particular I want to compress string of length >=30 characters, >> e.g. ACGATACGGCGACCACCGAGATCTACACTCTTCC >> >> The reason I want to do that is because, there are billions >> of such string I want to print out. And I need to save disk space. >> >> - Gundala Viswanath >> Jakarta - Indonesia >> >> ______________________________________________ >> R-help@r-project.org mailing list >> https://stat.ethz.ch/mailman/listinfo/r-help >> PLEASE do read the posting guide >> http://www.R-project.org/posting-guide.html >> and provide commented, minimal, self-contained, reproducible code. >> > > [[alternative HTML version deleted]] ______________________________________________ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.