Hi, newbie here, I was wondering if anyone can out, I have checked through the help archives but cannot find my answer.
I have three nexus files mostly with the same taxa but some are different. I want to concatenate the DNA sequences from these three files into one large nexus file but I cannot seem to accomplish it! This is an example: file1 taxon1 aaggttcc taxon2 aagtttcg taxon3 aaggttcc file2 taxon2 ctgctg taxon3 ctggtc taxon4 ctgctg file3 taxon1 ggttggtta taxon2 ggttggttc taxon4 ggttggttc this is what i want to end up with (where ? means missing data) in nexus format: taxon1 aaggttcc??????ggttggtta taxon2 aagtttcgctgctgggttggttc taxon3 aaggttccctggtc???????? taxon4 ??????????????ggttggttc Thanks in advance for any help! -- View this message in context: http://r.789695.n4.nabble.com/merging-nexus-sequence-files-tp3816907p3816907.html Sent from the R help mailing list archive at Nabble.com. ______________________________________________ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code.
