[Chris Lasher]
#- I have a rather large (100+ MB) FASTA file from which I need to
#- access records in a random order. The FASTA format is a
#- standard format
#- for storing molecular biological sequences. Each record contains a
#- header line for describing the sequence that begins with a '>'
#- (right-angle bracket) followed by lines that contain the actual
#- sequence data. Three example FASTA records are below:
#-
#- >CW127_A01
#- TGCAGTCGAACGAGAACGGTCCTTCGGGATGTCAGCTAAGTGGCGGACGGGTGAGTAATG
#- TATAGTTAATCTGCCCTTTAGAGGGGGATAACAGTTGGAAACGACTGCTAATACCCCATA
#- GCATTAAACAT
#- >CW127_A02
#- TGCAGTCGAACGAGAACGGTCCTTCGGGATGTCAGCTAAGTGGCGGACGGGTGAGTAATG
#- TATAGTTAATCTGCCCTTTAGAGGGGGATAACAGTTGGAAACGACTGCTAATACCCCATA
#- GCATTAAACATTCCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAAGGAATAGACGG
#- >CW127_A03
#- TGCAGTCGAACGAGAACGGTCCTTCGGGATGTCAGCTAAGTGGCGGACGGGTGAGTAATG
#- TATAGTTAATCTGCCCTTTAGAGGGGGATAACAGTTGGAAACGACTGCTAATACCCCATA
#- GCATTAAACATTCCGCCTGGG
#- ...
I think of two ways. If you have enough memory you could load everything in memory, each record as the element of a list, and then access randomly to the list.
If you want to keep the memory usage low, you can parse the file once and store in a list the byte position where the record starts and ends. Then access the list randomly and read each record with seek() and read().
. Facundo
Bit�cora De Vuelo: http://www.taniquetil.com.ar/plog
PyAr - Python Argentina: http://pyar.decode.com.ar/
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
ADVERTENCIA.
La informaci�n contenida en este mensaje y cualquier archivo anexo al mismo, son para uso exclusivo del destinatario y pueden contener informaci�n confidencial o propietaria, cuya divulgaci�n es sancionada por la ley.
Si Ud. No es uno de los destinatarios consignados o la persona responsable de hacer llegar este mensaje a los destinatarios consignados, no est� autorizado a divulgar, copiar, distribuir o retener informaci�n (o parte de ella) contenida en este mensaje. Por favor notif�quenos respondiendo al remitente, borre el mensaje original y borre las copias (impresas o grabadas en cualquier medio magn�tico) que pueda haber realizado del mismo.
Todas las opiniones contenidas en este mail son propias del autor del mensaje y no necesariamente coinciden con las de Telef�nica Comunicaciones Personales S.A. o alguna empresa asociada.
Los mensajes electr�nicos pueden ser alterados, motivo por el cual Telef�nica Comunicaciones Personales S.A. no aceptar� ninguna obligaci�n cualquiera sea el resultante de este mensaje.
Muchas Gracias.
-- http://mail.python.org/mailman/listinfo/python-list
