This time I have tried fasta benchmark since current entries does notdisplay 
correct output.Program is copy of mine 
http://benchmarksgame.alioth.debian.org/u64q/program.php?test=fasta&lang=gpp&id=1c++
 benchmark, but unfortunately executes more than twice time.
Seems to me that culprit  is in function random as I have tested rest of 
codeand didn't found speed related  problems.
bmaxa@maxa:~/shootout/fasta$ time ./fastahs 25000000 > /dev/null
real    0m5.262suser    0m5.228ssys     0m0.020s
bmaxa@maxa:~/shootout/fasta$ time ./fastacpp 25000000 > /dev/null
real    0m2.075suser    0m2.056ssys     0m0.012s
Since I am planning to contribute program, perhaps someone cansee a problem to 
speed it up at least around 3.5 secs which is speed of bench that display 
incorrect result  (in 7.6.1).
Program follows:
{-# LANGUAGE BangPatterns #-}{-  The Computer Language Benchmarks Game
    http://shootout.alioth.debian.org/
    contributed by Branimir Maksimovic-}
import System.Environmentimport System.IO.Unsafe
import Data.IORefimport Data.Array.Unboxedimport Data.Array.Storableimport 
Data.Array.Baseimport Data.Word
import Foreign.Ptrimport Foreign.C.Types
type A = UArray Int Word8type B = StorableArray Int Word8type C = (UArray Int 
Word8,UArray Int Double)
foreign import ccall unsafe "stdio.h"      puts  :: Ptr a -> IO ()foreign 
import ccall unsafe "string.h"      strlen :: Ptr a -> IO CInt
main :: IO ()     main = do    n <- getArgs >>= readIO.head
    let !a = (listArray (0,(length alu)-1)              $ map (fromIntegral. 
fromEnum) alu:: A)    make "ONE" "Homo sapiens alu" (n*2) $ Main.repeat a 
(length alu)    make "TWO"  "IUB ambiguity codes" (n*3) $ random iub    make 
"THREE" "Homo sapiens frequency" (n*5) $ random homosapiens
make :: String -> String -> Int -> IO Word8 -> IO (){-# INLINE make #-}make id 
desc n f = do    let lst = ">" ++ id ++ " " ++ desc    a <- (newListArray 
(0,length lst)         $ map (fromIntegral. fromEnum) lst:: IO B)    
unsafeWrite a (length lst) 0    pr a    make' n 0    where         make' :: Int 
-> Int -> IO ()        make' !n !i = do            let line = (unsafePerformIO 
$                         newArray (0,60) 0 :: B)            if n > 0           
     then do                    !c <- f                    unsafeWrite line i c 
                   if i+1 >= 60                         then do                 
           pr line                            make' (n-1) 0                     
   else                             make' (n-1) (i+1)                else do    
                unsafeWrite line i 0                    l <- len line           
         if l /= 0                        then pr line                        
else return ()
pr :: B -> IO ()pr line = withStorableArray line (\ptr -> puts ptr)len :: B -> 
IO CIntlen line  = withStorableArray line (\ptr -> strlen ptr)
repeat :: A -> Int -> IO Word8repeat xs !n = do        let v = unsafePerformIO 
$ newIORef 0        !i <- readIORef v        if i+1 >= n            then 
writeIORef v 0            else writeIORef v (i+1)        return $ xs `unsafeAt` 
i
random :: C -> IO Word8random (a,b) = do         !rnd <- rand        let        
     find :: Int -> IO Word8            find !i =                 let           
          !c = a `unsafeAt` i                    !p = b `unsafeAt` i            
    in if p >= rnd                    then return c                    else 
find (i+1)        find 0
rand :: IO Double{-# INLINE rand #-}rand = do    !seed <- readIORef last    let 
       newseed = (seed * ia + ic) `rem` im        newran  =  fromIntegral 
newseed * rimd        rimd      = 1.0 / (fromIntegral im)        im, ia, ic :: 
Int        im  = 139968        ia  = 3877        ic  = 29573    writeIORef last 
newseed    return newran    where         last = unsafePerformIO $ newIORef 42  
  alu    :: [Char]    alu =     "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\    
\GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\    
\CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\    
\ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\    
\GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\    
\AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\    
\AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
mkCum :: [(Char,Double)] -> [(Word8,Double)]mkCum lst = map (\(c,p) -> 
((fromIntegral.fromEnum) c,p)) $              scanl1 (\(_,p) (c',p') -> (c', 
p+p')) lst
homosapiens, iub :: C
iub' = mkCum [('a',0.27),('c',0.12),('g',0.12),('t',0.27),('B',0.02)        
,('D',0.02),('H',0.02),('K',0.02),('M',0.02),('N',0.02)        
,('R',0.02),('S',0.02),('V',0.02),('W',0.02),('Y',0.02)]
homosapiens' = mkCum [('a',0.3029549426680),('c',0.1979883004921)               
 ,('g',0.1975473066391),('t',0.3015094502008)]
iub = (listArray (0, (length iub')-1) $ map fst iub',        listArray (0, 
(length iub')-1) $ map snd iub')
homosapiens = (listArray (0, (length homosapiens')-1) $ map fst homosapiens',   
             listArray (0, (length homosapiens')-1) $ map snd homosapiens')
                                          
_______________________________________________
Haskell-Cafe mailing list
[email protected]
http://www.haskell.org/mailman/listinfo/haskell-cafe

Reply via email to