Your message dated Sun, 21 Jun 2015 15:51:57 +0000 with message-id <e1z6hxj-0003nt...@franck.debian.org> and subject line Bug#789488: fixed in seqprep 1.1-2 has caused the Debian Bug report #789488, regarding seqprep: FTBFS everywhere except on amd64/linux to be marked as done.
This means that you claim that the problem has been dealt with. If this is not the case it is now your responsibility to reopen the Bug report if necessary, and/or fix the problem forthwith. (NB: If you are a system administrator and have no idea what this message is talking about, this may indicate a serious mail system misconfiguration somewhere. Please contact ow...@bugs.debian.org immediately.) -- 789488: http://bugs.debian.org/cgi-bin/bugreport.cgi?bug=789488 Debian Bug Tracking System Contact ow...@bugs.debian.org with problems
--- Begin Message ---Package: seqprep Version: 1.1-1 Severity: serious Justification: fails to build from source Hi, seqprep fails to build everywhere: https://buildd.debian.org/status/package.php?p=seqprep&suite=unstable either (e.g. arm64) with fakeroot debian/rules binary-arch dh binary-arch dh_testroot -a dh_prep -a dh_auto_install -a make -j1 install DESTDIR=/«PKGBUILDDIR»/debian/tmp AM_UPDATE_INFO_DIR=no make[1]: Entering directory '/«PKGBUILDDIR»' cp SeqPrep /sbuild-nonexistent/bin cp: cannot create regular file '/sbuild-nonexistent/bin': No such file or directory make[1]: [install] Error 1 (ignored) Makefile:16: recipe for target 'install' failed make[1]: Leaving directory '/«PKGBUILDDIR»' debian/rules override_dh_install make[1]: Entering directory '/«PKGBUILDDIR»' dh_install sed -i 's#../SeqPrep#/usr/bin/seqprep#' /«PKGBUILDDIR»/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh sed: can't read /«PKGBUILDDIR»/debian/seqprep-data/usr/share/doc/seqprep/examples/RUNTEST.sh: No such file or directory make[1]: *** [override_dh_install] Error 2 debian/rules:28: recipe for target 'override_dh_install' failed make[1]: Leaving directory '/«PKGBUILDDIR»' make: *** [binary-arch] Error 2 debian/rules:5: recipe for target 'binary-arch' failed dpkg-buildpackage: error: fakeroot debian/rules binary-arch gave error exit status 2 why is the install error ignored? this should fail earlier ... why is it going to touch $HOME? or with testsuite output mismatch (e.g. i386): debian/rules override_dh_auto_test make[1]: Entering directory '/«PKGBUILDDIR»' # This checks that the tests run and produce byte-identical results. cd Test && mkdir -p out info && \ bash -xc 'gzcat(){ zcat "$@" ; } ; . RUNTEST.sh' + . RUNTEST.sh ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_merged_1.fastq.gz -2 ./out/pe_bad_contam_merged_2.fastq.gz -s ./out/pe_bad_contam_merged_s.fastq.gz -E ./info/alignments_merged.txt.gz Processing reads... \ Pairs Processed: 100000 Pairs Merged: 14306 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.346382 ++ ../SeqPrep -6 -f ./data/multiplex_bad_contam_1.fq.gz -r ./data/multiplex_bad_contam_2.fq.gz -A GATCGGAAGAGCACACGTCT -B AGATCGGAAGAGCGTCGT -1 ./out/pe_bad_contam_trimmed_1.fastq.gz -2 ./out/pe_bad_contam_trimmed_2.fastq.gz -E ./info/alignments_trimmed.txt.gz Processing reads... \ Pairs Processed: 100000 Pairs Merged: 0 Pairs With Adapters: 4091 Pairs Discarded: 2228 CPU Time Used (Minutes): 0.342337 ++ prog=gzcat ++ gzcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ python seqlens.py ++ zcat ./out/pe_bad_contam_trimmed_1.fastq.gz ++ gzcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ zcat ./out/pe_bad_contam_trimmed_2.fastq.gz ++ python seqlens.py ++ gzcat ./out/pe_bad_contam_merged_1.fastq.gz ++ python seqlens.py ++ zcat ./out/pe_bad_contam_merged_1.fastq.gz ++ gzcat ./out/pe_bad_contam_merged_2.fastq.gz ++ python seqlens.py ++ zcat ./out/pe_bad_contam_merged_2.fastq.gz ++ gzcat ./out/pe_bad_contam_merged_s.fastq.gz ++ zcat ./out/pe_bad_contam_merged_s.fastq.gz ++ python seqlens.py [ `cat Test/info/pe_*.txt | md5sum | cut -b -10` = 8bc8e0787e ] make[1]: *** [override_dh_auto_test] Error 1 debian/rules:19: recipe for target 'override_dh_auto_test' failed make[1]: Leaving directory '/«PKGBUILDDIR»' make: *** [build-arch] Error 2 dpkg-buildpackage: error: debian/rules build-arch gave error exit status 2 debian/rules:5: recipe for target 'build-arch' failed Andreas
--- End Message ---
--- Begin Message ---Source: seqprep Source-Version: 1.1-2 We believe that the bug you reported is fixed in the latest version of seqprep, which is due to be installed in the Debian FTP archive. A summary of the changes between this version and the previous one is attached. Thank you for reporting the bug, which will now be closed. If you have further comments please address them to 789...@bugs.debian.org, and the maintainer will reopen the bug report if appropriate. Debian distribution maintenance software pp. Andreas Tille <ti...@debian.org> (supplier of updated seqprep package) (This message was generated automatically at their request; if you believe that there is a problem with it please contact the archive administrators by mailing ftpmas...@ftp-master.debian.org) -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA512 Format: 1.8 Date: Sun, 21 Jun 2015 16:31:54 +0200 Source: seqprep Binary: seqprep seqprep-data Architecture: source all amd64 Version: 1.1-2 Distribution: unstable Urgency: medium Maintainer: Debian Med Packaging Team <debian-med-packag...@lists.alioth.debian.org> Changed-By: Andreas Tille <ti...@debian.org> Description: seqprep - stripping adaptors and/or merging paired reads of DNA sequences w seqprep-data - example data set for seqprep - only used for testing Closes: 789488 Changes: seqprep (1.1-2) unstable; urgency=medium . * Do not try fiddle around with arch all files in arch indep builds Closes: #789488 Checksums-Sha1: 5492f0a7fddca06056751110bfec51bb7b94b619 2083 seqprep_1.1-2.dsc 536c4cf82be4fc1698e3a0aa4693b5089459ee69 8152 seqprep_1.1-2.debian.tar.xz 06e3ef81dbf64888170e702a515c31704234daab 34946686 seqprep-data_1.1-2_all.deb f33f33ebc8e3caf1282c004b2e66ad3a3c184521 26516 seqprep_1.1-2_amd64.deb Checksums-Sha256: e46d251c47dfaafe3013b5a5b74800dab67dbe793cbb85f139d969fb57fbe640 2083 seqprep_1.1-2.dsc 22f18e215f2baa9f4df346c8fb8fbad3fea5860fc69770853fb7c285a107d828 8152 seqprep_1.1-2.debian.tar.xz e469b48e42c402e61d69b93322d61466cd7e6d882b413463f4a336fd64f42136 34946686 seqprep-data_1.1-2_all.deb 77474648b4c845b6723f210a1267a9511d12aee809a92878fd59cb2285673d0d 26516 seqprep_1.1-2_amd64.deb Files: 3bd87454f63f3c36a045c0df6875f56a 2083 science optional seqprep_1.1-2.dsc ee37552578458552298f0517f6d64cb9 8152 science optional seqprep_1.1-2.debian.tar.xz dc695d4577203902d149bc39d3a88f84 34946686 science extra seqprep-data_1.1-2_all.deb 214aa6800514b8ff6290df434acd01fc 26516 science optional seqprep_1.1-2_amd64.deb -----BEGIN PGP SIGNATURE----- Version: GnuPG v1 iQIcBAEBCgAGBQJVhtThAAoJEFeKBJTRxkbRrkcP/1R6Rfsww166SVwtepQfS2nd lcQ5ejPFZ91VSsSTy/uUTa8vQqftWwu3TMDVKXi5g+/grDAXPqf4ugg0FCB59Ao5 TveWHoNaf8+Uqri6hNvYh3s2uUAswQn4LE2s8MFle53s8rMLWe0stnhl5aFuzQJZ rzYuH419hvH0IyGn7EIFAKnRlSlua68NnFZWxBxT3H9Vw5KhVuip+g5RqewinvAs yEgCHVlYadKJ5syH/ugXae2eIuJpQ2DG4Bg0okJ7Gq4O+wAQgGeMtEZPP+r2Ce0B jwRTWH1uHTyyHcS6+l/m88QvagMY7WvtnZILaIbBpqo/bLWUxK4vJtCahH3az/Y3 tY1CGpjZa5a1sWKRMv2cgrYKZogc51fnbStm7yQRTruxyC7PdYw3lqQcsGCboG7L psubA5jLLDK/jGw+4EDvNzNAyxL+V4e5+RP/zotNUHBeS/8yGizQm4I+DtTnJoDT knr94DPXjswWC5RChV2bJbY4IywZz77Alww5pjnrVUz+T5jw+4/rV/V+1JSyTelj NVJnqb2/PYHNkbDJ6tGPdz0abBzhuofiTV5wXA5qeEOS3tXqk9BK3/VD5m+Xyobz vrhhqqSFgTPxXzEuRoWESHtLKxelVhtXQWkr+y3Y1wWOwoVBYGPegWx7fbGxASz4 Bc8PRwaxpumZneQdMGE0 =f1vT -----END PGP SIGNATURE-----
--- End Message ---
