On 07/12/24 18:53, Nilesh Patra wrote:
On 07/12/24 4:25 pm, Étienne Mollier wrote:
There does not seem to have been much changes. Maybe the error
is somewhere else? I hope I ran the test properly, it was a bit
intricate.
Your earlier reply to the bug report had this trace:
/usr/include/c++/14/bits/stl_vector.h:1130:
std::vector<_Tp, _Alloc>::reference
std::vector<_Tp, _Alloc>::operator[](size_type)
[
with _Tp = ChainedMatchPos;
_Alloc = std::allocator<ChainedMatchPos>;
reference = ChainedMatchPos&;
size_type = long unsigned int
]: Assertion '__n < this->size()' failed.
/tmp/autopkgtest.WdOt0L/build.sPS/src/debian/tests/run-unit-
The Assertion failure "'__n < this->size()' failed." indicates that the index
is going out of bounds in the vector. (upper bound)
Do you still see this trace? If so, maybe the versions are not tested
correctly?ensuring blasr is built against patches pbseqlib?
I tried this on a debian:unstable docker container and it does seem to pass for
me
On plain build of blasr:
root@306d2e75fdf4:~/blasr-5.3.5+dfsg# bash ./debian/tests/run-unit-test
[INFO] 2024-12-08T08:46:54 [blasr] started.
/usr/include/c++/14/bits/stl_vector.h:1130: std::vector<_Tp, _Alloc>::reference std::vector<_Tp,
_Alloc>::operator[](size_type) [with _Tp = ChainedMatchPos; _Alloc =
std::allocator<ChainedMatchPos>; reference = ChainedMatchPos&; size_type = long unsigned int]:
Assertion '__n < this->size()' failed.
Aborted (core dumped)
With pbseqlib patched and installed on the container, and building blasr
against it:
root@306d2e75fdf4:~/blasr-5.3.5+dfsg# bash ./debian/tests/run-unit-test
[INFO] 2024-12-08T08:48:39 [blasr] started.
[INFO] 2024-12-08T08:48:39 [blasr] ended.
[INFO] 2024-12-08T08:48:39 [blasr] started.
[INFO] 2024-12-08T08:48:39 [blasr] ended.
alignment.sam
@HD VN:1.5 SO:UNKNOWN pb:3.0.1
@SQ SN:test/0/0_68 LN:59 M5:157f8fd9cd009034b02081c9fa7a1084
@RG ID:e70794ea PL:PACBIO
DS:READTYPE=SUBREAD;DeletionQV=dq;DeletionTag=dt;InsertionQV=iq;MergeQV=mq;SubstitutionQV=sq
PU:query.fasta PM:SEQUEL
@PG ID:1 PN:BLASR VN:5.3.5-5.3.5 CL:blasr query.fasta ref.fa
--sam --out alignment.sam
movie/0/0_51 0 test/0/0_68 1 254 50=1S * 0
0 ATGTCAGTGACGATGACAGTAGACAGATAGAGAGGAGAGATAGACAGATAG *
RG:Z:e70794ea np:i:1 qe:i:51 qs:i:0 zm:i:0 AS:i:-250 NM:i:0
alignment.sam.check:
@HD VN:1.5 SO:UNKNOWN pb:3.0.1
@SQ SN:test/0/0_68 LN:59 M5:157f8fd9cd009034b02081c9fa7a1084
@RG ID:e70794ea PL:PACBIO
DS:READTYPE=SUBREAD;DeletionQV=dq;DeletionTag=dt;InsertionQV=iq;MergeQV=mq;SubstitutionQV=sq
PU:query.fasta PM:SEQUEL
@PG ID:1 PN:BLASR VN:VERSION CL:blasr query.fasta ref.fa
--sam --out alignment.sam
movie/0/0_51 0 test/0/0_68 1 254 50=1S * 0
0 ATGTCAGTGACGATGACAGTAGACAGATAGAGAGGAGAGATAGACAGATAG *
RG:Z:e70794ea np:i:1 qe:i:51 qs:i:0 zm:i:0 AS:i:-250 NM:i:0
output: OK
alignment.sam.check: OK
Expected output and generated output are same: PASS Test
